Gene detail

Detailed information of agem_s0062.g86.t2 in Acropora gemmifera

Genomic Location: sc0000062_pilon:882127...886886
NR annotation: XP_029184739.2, lysophosphatidic acid receptor 1-like [Acropora millepora]
Species Acropora gemmifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

agem_s0062.g86.t2

GTAACATTTGCATACTGTTCTTCGAGAAGAGGAAATATCGTCAGAAAATGTTAAACTGGAAAGAGAGGTGCATGGATATATTGCCCTTTGCTCTGTTTTTCCTCATCAACTCTCTCGCACCTTCTCTTTCAACATCTGTCGTAGAGAATTGCGTCACGCCAACATGTATTTGTTCATATGATCTTATATATAACATAACAGCTACTTGTCACACAAAGGATTTGAAAAATGACCTGCTCCGTTACATCAAGAGACCATTGTTGATTGGTGCCATTACAATCATAGACGACAACACAACTGTCATTCCAGAACAAACTTTTACGCAGTTTGCAAATTTAAAGTGCTTGAAGATCAAAATAGGACTTTTGAAGATATGGAAGGGTAACCTCTCTAGAGAACTTCCATCACTTGAGATCCTTTCTCTTGAAACGCGCAGTCTATTTGCCATTCCAGAACATGTCCTCCGGTCGCCCAAGCTCCAAACTATCAATGGCGTGACGTGGAGTAACGCTTGCGAAAACTGTACTTTGGTCAAGAATGAAACTCACGAAAATGTCACGCACCTTAAAAGAGGAACATATGACTACTATCCAAGGACACGCTGTCGCGGCTCACGGTTCGTGGTACACGATGTGTCGCGCACAATTGCTGGTCACGGGTTTTTACCGATTTGTTTGTTGACAAATCAGCGATGTTTTTCGTCTCAAATTACCATTATCCCTATGCATCGATGTTGGGATAGTGCCAACAATGTTCTCTACGTTGAATACTTTTTCGCTCCTTTGATACTCGTTTTTAACTTTATCATATTTTCAACAACACTGACAGCTAAGTCTCTGAAGAATATCCCAACCATGTTATTGGTCTCCAACTTGGCAGTTAGCGACTTCTTTTACGGAGTTTATTCTCTCGTTATTACTTGTTTGCGTCATGCAATGTCTTACCAAATCTTTGTTGGTGCTATGGATCAGCTATGTCCGTTTCTCGGTTTTTTGTGGTGTAGTGTTCAAGTCGTTGCAGCTCTTTCAGCATTACTTCTTACAGCTGACCGATACGTAGCCATCATCTTTTCGATGAGACCGGACATGAAGTTTTCACCCAAATCTTGCTTAATCGGTGTTACCATATCGTGGACGCTTGCCTTACTGGTAGCTTCTCTTCCATTTTTACGCATTGGTACCTACACCTCTACAACGTTTTGTCTTCCAATTCAGCCAGCCAAAGGGATTCCGCATTCGTTCGCATACAGCGCCAGTCTCGTGGCAATTGGAATAGTTTTATACATAATCACTATACCAATGTATCTGCACATCTTTCTTCATGTAAGGCGCTCTGGAAACCAAATGGGTATCAAAAGAGATGGTAAACTAGCCAAGAAGATTTCTCTATTGGTAGTTAGCAACTTCATGTTTTTTCTACTCCCAGTTTTTATCGGTCTTATATGGTTATTCACCAAGGCTTTCGACAGTCTTCCTCTGAGCACAAGAGAGATTCTCGTTGGTTCTTTCTCTATCATTTGTCTCAGTGTTAATTCATTCATAAATCCTCTTCTTTACGCGTTCAGAGACAGGAGATTTCTATTTGTGATCAGAAAAAGATATCGCCGAGTTTTTCATCCAAACAATGTTGAAGTTTTTAATACTACGTCAAGAACTGAAGCTAGATCTGATCAACATGAAATGATAAAGAGACGGTAGACAAAGCGAGCTCTTCTCAATCCCAAAACAAGGGCTTTTCTCTTTTACATACGACCCAGGATAGACTGGGAGACTGTTTCAGAATCAGCAGTTAATTTCTTGTCAGTAGAACCCTGTGTTGCATTCTTGTGGTCTATTTCTGGGTTCCTGTTTGCCTCTCGCGGTACGCAATCACTTGAATGGAGATGAGTTTCGTATTTTCATTTTAAATCAAAGTCATTCTGTTTTCTACGGATTGGCGTCAAGACCTGGGTTGAACCAGAGGTAAGCAGCAACTCAAAGATAGGTTATTGGGTCGCATGCCTAAAATAGAATATTTCTCGATCGTTTTGATTCTTGCGCATGCGTTTTGTCAATAACTATATACACTGATTTGTCGTAAACCATCATGGTACCACTTGCGATATTTTTAATCACGAAAGGGTAGTTATGAACTAATTCCAGTCAAATTTAGTTTTGTACGAGCTTAGAGTCTTCAGTCTTGGCAAATAATTGTAACGACGGAAA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000975 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00001 all species →	7tm_1	7 transmembrane receptor (rhodopsin family)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017452 all species →	Domain	GPCR, rhodopsin-like, 7TM	Interproscan
IPR000276 all species →	Family	G protein-coupled receptor, rhodopsin-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24372 all species →	GLYCOPROTEIN HORMONE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007189 all species →	Biological Process	adenylate cyclase-activating G protein-coupled receptor signaling pathway	Interproscan
GO:0007190 all species →	Biological Process	activation of adenylate cyclase activity	Interproscan
GO:0008528 all species →	Molecular Function	G protein-coupled peptide receptor activity	Interproscan
GO:0009755 all species →	Biological Process	hormone-mediated signaling pathway	Interproscan
GO:0004930 all species →	Molecular Function	G protein-coupled receptor activity	Interproscan
GO:0007186 all species →	Biological Process	G protein-coupled receptor signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for agem_s0062.g86.t2.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of agem_s0062.g86.t2 across 48 RNA-seq samples of Acropora gemmifera. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

48Samples

0TPM > 0

1Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
branch tip	48	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR2169558	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169421	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169422	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169423	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169425	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169426	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169518	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169527	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169528	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169529	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169530	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169531	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169532	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169533	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169534	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169535	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169536	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169537	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169538	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169539	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169540	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3169541	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182410	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182448	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182557	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182684	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182685	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182686	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182775	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182776	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182777	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182778	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182779	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182780	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182781	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182784	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182785	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182786	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182787	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182788	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182789	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182790	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182791	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182792	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182793	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3182794	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3223317	branch tip	branch tip	not recorded	not recorded	SRP062488
SRR3223319	branch tip	branch tip	not recorded	not recorded	SRP062488

Source: CnidoSite RNA-seq expression matrices (AGEMM_TPM, StringTie quantification over 48 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.