Gene detail

Detailed information of agem_s0120.g20.t1 in Acropora gemmifera

Genomic Location: sc0000120_pilon:478354...490027
NR annotation: XP_029190892.2, smoothened homolog isoform X1 [Acropora millepora]
Species Acropora gemmifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

agem_s0120.g20.t1

GTCGAGGTGATGCTTTCGCAATTTCTCCCTCTTGGATTCAATGTTTAAGACAAACTTATGCTTCCTTCTCGATATTTTGCGGGAATGCAATGGCTTCATGTTTTGATATTGCTGCATTGCTTGCTCAAAGCGACAGGGGCAAATTACAAATGCGAAACTCTACGGCATCGAAAATGTTTGGGTTCTACCTTGGAGTACAATTTTACAACTTTACAATTGGTCACGGATTCTAGCAATCAAGATCAAGTTCAGTCCAATCTGGAAAAATGGAAAGGCTTAAAATTTCTTTCTAACTGTTGGTCTGTTCTCCAACCACTTTTGTGCCAAGTGTACATGCCAGAATGCCAAGCCGACGGTTCTGTCCGGTTACCGTGTCGAGAACAGTGTGAAGCCACAAGAGAGCCGTGTTCTGTAGTGGAACGCTACAATAAAAAATGGCCCGACTTTTTAATATGTGCAAACTTTAAGGAAGGCGATTGCAAAGTAACAGAACTCCAACTCAATGAATCTGCGTGCAAACGTCCATTGGTTGAAACATCTCACAAGTCCAGCTGGTATGAAGGAATACAGGGCTGTGGAATTCAATGTGAAAATCCCATCTTTGACAAAGAAGAACACACAAGAATTCACAGATTTGTGGGTGCATTTGGAAGCCTGTCATTTGTATGCAGCCTTTTTACAGTGGTCACATTTTTAATTGGTTGGAAGTCCCAGAATCGCTATCCATCAGTCATTCTGTTTTATATGAACAGTTGTTTCTGTGCTGCTTCCTTGGGTTTCCTTATTCAGTTTACTGACGGTGCAAGAGATCGAACTGTTTGTCGTAAGGATGAAACAATGCGACTGCAAGAACCAAGTGAGGATGACAGTTTCCTTTGCATTCTGACATTTGTCTTGGTATATTACTTCTCCATGGTTGGTGCAGTGTGGTTTGTTATCCTTGCATACTCGTGGTCTATTTGTTTCAAATCTCTTGGGAGTACTAGGGATAACTTTGTAGGGAAGGTGATATATTTTCATTGCATAGCATGGATTGTTCCCCTCACTTGGACAGTCAGCATTCTTGCCCTAAAACAGGTTGATGCTAACTCTCTCAGTGGAATTTGTTTTGTTGGATATAAAAATCCTAAAATGAGAGCTGGTTTTCTGCTGGCACCATTGGGCCTTGACTTGCTCATTGGTGGAATTTTCTTAATATATGGTATGATCACTCTATGTAAGCTACGTAAATCAAATCCCAATTTTCTGAGCAGCAGAGCAGCTCATAAAATAAAGGAAACCATAGTTCGAGTTGGTATATTTTCTGTGATATCATTTTTGACAGTATTTATTACTTTTGCCTGTCATGTTTATGAGTACCATAACCAGCACAAATGGGAGGAGAGTTACATGAAGTTTATCTGGTGCATTGCCGAAAAAGCAGCAGATGGTGGAAAATCATGGAATAAAAATGACTGCTCAGTGAGTGACCGTCCCAATCTGGGAATCATTGAGTTGGAGCTGGCCTCTCTATTTGGAACTGGGATTGCAATGAGCAGCTGGACGTGGACTTCAAACACACTACAAACATGGCAAAAGTTATGGCGCAAGATAACAAGAAAGAACAGACATCCTGAGCTCAGTCACTACAAAACTATAAGGAGAATGAAGAACAGAGTAGCACCAGCTCTTCTTTACCCTGCCATACCAGATGTACAAATGGATGCAGTTATGAAGGCAGGAGAGGCTATTCAAGCTCATGGTTCTAAAAGGAAAGACTGCTTAGAAATACCCGAAGAACCACTAAAGCTTAAAAGCATTTCTGAATTGAGTCCACAGGAGAATATTAGTCAATAGATTGAAGGGCATGTTGGGGTGGAAATTTTGATTTTATTTATATCTTTAGTCACATCATGTACCTGACAGCACTCAAGAAAGAACAGCCATTCATTAGCCTCATCTTGAAATGAATTTCCACCACAACATGCAAATGCCCATCTCAGTAGGTGTACAGCAGAATGTAAGATAAAAACATTATTTTTGCAAATTAGGCGAACAAATGAGTATTTAATACTGTAACTTCCAGTTTGTGCATAGAGCTTTGAGTTGAACCAAGTCTAGAATTCAGTATATGCACATCATCCACTAGATTATAATAAATTATATGATAATTA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P97698	Protein smoothened OS=Rattus norvegicus OX=10116 GN=Smo PE=2 SV=1
P56726	Protein smoothened OS=Mus musculus OX=10090 GN=Smo PE=1 SV=2
Q99835	Protein smoothened OS=Homo sapiens OX=9606 GN=SMO PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007723 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01392 all species →	Fz	Fz domain	Domain	Interproscan
PF01534 all species →	Frizzled	Frizzled/Smoothened family membrane region	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020067 all species →	Domain	Frizzled domain	Interproscan
IPR000539 all species →	Domain	Frizzled/Smoothened, 7TM	Interproscan
IPR036790 all species →	Homologous_superfamily	Frizzled cysteine-rich domain superfamily	Interproscan
IPR017981 all species →	Domain	GPCR, family 2-like, 7TM	Interproscan
IPR015526 all species →	Family	Frizzled/secreted frizzled-related protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11309 all species →	FRIZZLED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0007166 all species →	Biological Process	cell surface receptor signaling pathway	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004888 all species →	Molecular Function	transmembrane signaling receptor activity	Interproscan
GO:0005113 all species →	Molecular Function	patched binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005929 all species →	Cellular Component	cilium	Interproscan
GO:0007224 all species →	Biological Process	smoothened signaling pathway	Interproscan
GO:0007389 all species →	Biological Process	pattern specification process	Interproscan
GO:0007417 all species →	Biological Process	central nervous system development	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0030425 all species →	Cellular Component	dendrite	Interproscan
GO:0071679 all species →	Biological Process	commissural neuron axon guidance	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06226	SMO; smoothened	-	G protein-coupled receptors	ko04030	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of agem_s0120.g20.t1 across 48 RNA-seq samples of Acropora gemmifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

48Samples

3TPM > 0

1Conditions

44.9Max TPM

2.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
branch tip	48	3	2.28	44.93

Per sample · hover a bar for the full sample record

Show the sample table (48 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR2169558	branch tip	branch tip	not recorded	not recorded	SRP062488	44.93
SRR3223317	branch tip	branch tip	not recorded	not recorded	SRP062488	41.25
SRR3223319	branch tip	branch tip	not recorded	not recorded	SRP062488	23.04
SRR3169421	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169422	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169423	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169425	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169426	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169518	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169527	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169528	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169529	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169530	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169531	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169532	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169533	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169534	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169535	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169536	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169537	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169538	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169539	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169540	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169541	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182410	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182448	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182557	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182684	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182685	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182686	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182775	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182776	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182777	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182778	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182779	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182780	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182781	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182784	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182785	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182786	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182787	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182788	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182789	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182790	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182791	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182792	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182793	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182794	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00

Source: CnidoSite RNA-seq expression matrices (AGEMM_TPM, StringTie quantification over 48 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora gemmifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	8	agem_s0066.g59.t1	0.999998261822049
Negatively correlated	3	agem_s0028.g73.t1	-0.59795906283663

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora gemmifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →