Gene detail

Detailed information of agem_s0205.g12.t1 in Acropora gemmifera

Genomic Location: sc0000205_pilon:232036...240554
NR annotation: XP_029211889.1, splicing factor 3A subunit 2-like [Acropora millepora]
Species Acropora gemmifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

agem_s0205.g12.t1

GACTCAGTACCAATCCCGCGCGATTGTTCGGCCGCCATGATTTTTCAACGCTGAAGACACGTTTGTTAGATGAAAGATGGATTTTCAGAATCGTGCTGGTGGAAAGACAGGCTCGGGTGGTGTTGCGTCATGGTCAGAATCAAACAGAGATCGCCGAGAACGTCTCAGGCAGCTTGCTTTGGAGACAATCGACCTCAACAAGGATCCATATTTTATGAAAAACCATCTTGGTTCCTATGAATGCAAGCTTTGTCTTACGCTACACAACAATGAGGGAAGCTACCTTGCTCATACACAAGGAAAAAAACATCAGTCGAACCTTGCTCGTCGTGCTGCAAAAGAGGCTAAGGAAGCACCAGCCCAGCCAGCACCGGAAAAACCTAGGGTGTCTATTAAGAAGTTTGTGAAGATTGGTCGTCCAGGTTACAAAGTCACAAAACAAAGAGATCCAGAGTCAGGACAACACAGTCTATTATTCCAGGTGGACTATCCAGAAATAGCTGAAGGTATTGCACCAAGACATCGCTTCATGTCCGCTTATGAACAACGCATAGAACCACCAGACAAGTCATGGCAGTACCTCCTTTTTGCAGCTGAGCCGTATGAAACTATTTCCTTCAAGATTCCAAGTCGTGAAATTGACAAAGATGATGGAAGACTCTGGACTCATTGGAATAAAGACACTAAACAGTTTTTCCTTCAATTCCACTTCCGCCTGACACCTGCTCAAATTCAACAGCAACAACAGCAAAAAAGAGGTGGTGGTAATCAGCAAGGAGGGATGCCAACTGGTCTTATCCCTCCACCCCCAAGGAACATCCCATCTGCCAACCCCCTCAACCCTTTTGCTCAGCGCTGACTTGACTTTAGTTTAAGTTAAATTTGAAGCCCATTTTGTTTTTTGTCATGTGAAAAGTTCATTGTCAATAAAAGTGCTAAAATACTGAACTGAAAGTAGAGATGTTTCTTTTTTTGTTGTTAACTGTACTTGCACAGTTTGTATGAAAGAATGCTTGCTTTTTTAACTGCCAATCAACCAAAACAGTTGAGGAGTCAAGGACTGAAAACCACATAGTCTGGTTTACACAATCTTAAGGCCAAAATCTCAAGAATAACTGTAAAGATATGAGGCTTTGGCAACAGTACCAACAAAAGTAAACAACAGCAAAAAATACACTGCATACTGATTGAAAATGACAACATATGAATCAAAGGACCATTACAGTAATAGCTTTGAAACAATCATAAGTATACTATAGGCCTGGTGAAAATTTTCAGTTAAGTAAATTACAACTTTTGCCCTTATCTACCGCAATATTACTATATTTAACAAGCTATTCAAAGCACCTTCTATTTCCTAATAATTGTATTTTTTCAACTTGAGTGACAGTGAATTTTCCTATGCGAAATCTTATGCCTTTTTCTTTGACAGATCAGCAGAAAGTGGGTTTTTTTTTGTACTAACAGGTAGATTACAAGGTGGTCTTGTAAGAAAGACCTTATAAGAACTACAACGATTGCTCAGCCTTTGTAACGAAATGACAACTTTAGGGAAAAACAAACCAAATTAAAAAAAGCTTATTTTTGTGCCAGAGTGTAGGCTGGTATTTCAATCACAGGGCTTAGTAGGTTGGTTAAGTAGGGTTTTCATGATAGTTAACACTGGTTAGCAAAAGCTATTGGCAACCAGCTTTAAGCTGATACCCACTCTAAATAATACAATTATGTTTTGTTTACTCTCTCTGAGAAGAGGCACTTGAAAACCAACAAGTGAAATGAAATCAACTTTAAAAATGAGTCTGTAAGGTGAAACTCAAGCTATCATGATGTAAAAGAAAATTTCTATTTCCAAGGCAGTATTAAGAGGAAGAAAGAAAAGTGAACTCAATCAAAATTGTGCTGTGAAGTCCACTGGTTTCATAACAAAAATTAATGAATTCTCAGTTCTTCAGGTAGGGTTAATAATGGTTTTAATTTCATCTTAATGCAGTAACAGGCCACCATTCCACATATCAGTTGACTTCCTGGGTCTCCTGTTTTCACAAAGTGTTCTCTCTTTTTGACCAGACATAACCAATTAAGTGGTAAACTTAAAGTAAGCAGCTTTCACCTTTGACCTCATAGCAAAAATGTTATTGTTAGTCGTGCAATCTTTGGCCCATAATGCGATTAAAAGAAAATGCTGAGTTTGTTTTTGCAAACAAAATAGTGTTTTGACCGTTGTTAAGTCCAACATTGTTGCACATCCCAAACATTTTCGCTGAATATAAGCAACAACTCTAGCCATTTGGCTTTGGGGTAAGAAAATAACCCAAGAAAAATAGACATTAGATTAGGGTGTGTCATTGCAAAAATAATTCAATCGAAACCTGCCTCAAATTGAACTAACAAAGTTTGGCATTTCAAATTAGGTTTTCCCTTCCCATTGGATTTAAAACTGATTTGAATCCCTAGATGCAAGAGTTTAATAATGGACCCAGGGCCAAGACAGTTCCTAGATTTAAGCCAAAACTACCATTTTCTGGCCTAAAAAAGCAGGTGCAATAGGGATTAAATTTCATAACAGAATCAGATACTTCCCCATAAAAATCACACCATCTCTATAACCTTCCTTAAAGAAAAATATTAAGATATG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q15428	Splicing factor 3A subunit 2 OS=Homo sapiens OX=9606 GN=SF3A2 PE=1 SV=2
A5PJN8	Splicing factor 3A subunit 2 OS=Bos taurus OX=9913 GN=SF3A2 PE=2 SV=1
Q6AXT8	Splicing factor 3A subunit 2 OS=Rattus norvegicus OX=10116 GN=Sf3a2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005143 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16835 all species →	SF3A2	Pre-mRNA-splicing factor SF3a complex subunit 2 (Prp11)	Domain	Interproscan
PF12874 all species →	zf-met	Zinc-finger of C2H2 type	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR052092 all species →	Family	Splicing Factor 3A Subunit 2	Interproscan
IPR031781 all species →	Domain	SF3A2 domain	Interproscan
IPR003604 all species →	Domain	Matrin/U1-C-like, C2H2-type zinc finger	Interproscan
IPR000690 all species →	Domain	Matrin/U1-C, C2H2-type zinc finger	Interproscan
IPR013087 all species →	Domain	Zinc finger C2H2-type	Interproscan
IPR036236 all species →	Homologous_superfamily	Zinc finger C2H2 superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23205 all species →	SPLICING FACTOR 3A SUBUNIT 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000245 all species →	Biological Process	spliceosomal complex assembly	Interproscan
GO:0005686 all species →	Cellular Component	U2 snRNP	Interproscan
GO:0071004 all species →	Cellular Component	U2-type prespliceosome	Interproscan
GO:0071013 all species →	Cellular Component	catalytic step 2 spliceosome	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12826	SF3A2, SAP62; splicing factor 3A subunit 2	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of agem_s0205.g12.t1 across 48 RNA-seq samples of Acropora gemmifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

48Samples

22TPM > 0

1Conditions

850.1Max TPM

210.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
branch tip	48	22	210.19	850.11

Per sample · hover a bar for the full sample record

Show the sample table (48 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR3169539	branch tip	branch tip	not recorded	not recorded	SRP062488	850.11
SRR3182789	branch tip	branch tip	not recorded	not recorded	SRP062488	731.53
SRR3169537	branch tip	branch tip	not recorded	not recorded	SRP062488	714.55
SRR3169533	branch tip	branch tip	not recorded	not recorded	SRP062488	677.73
SRR3169425	branch tip	branch tip	not recorded	not recorded	SRP062488	636.42
SRR3169527	branch tip	branch tip	not recorded	not recorded	SRP062488	587.20
SRR3169535	branch tip	branch tip	not recorded	not recorded	SRP062488	585.64
SRR3169528	branch tip	branch tip	not recorded	not recorded	SRP062488	561.54
SRR3169426	branch tip	branch tip	not recorded	not recorded	SRP062488	528.62
SRR3169423	branch tip	branch tip	not recorded	not recorded	SRP062488	526.31
SRR3169541	branch tip	branch tip	not recorded	not recorded	SRP062488	514.53
SRR3182448	branch tip	branch tip	not recorded	not recorded	SRP062488	498.01
SRR3169422	branch tip	branch tip	not recorded	not recorded	SRP062488	407.80
SRR3169532	branch tip	branch tip	not recorded	not recorded	SRP062488	359.06
SRR3169518	branch tip	branch tip	not recorded	not recorded	SRP062488	348.96
SRR3169530	branch tip	branch tip	not recorded	not recorded	SRP062488	324.36
SRR3169531	branch tip	branch tip	not recorded	not recorded	SRP062488	290.76
SRR3182792	branch tip	branch tip	not recorded	not recorded	SRP062488	262.29
SRR3182684	branch tip	branch tip	not recorded	not recorded	SRP062488	243.79
SRR3223319	branch tip	branch tip	not recorded	not recorded	SRP062488	162.19
SRR2169558	branch tip	branch tip	not recorded	not recorded	SRP062488	143.17
SRR3223317	branch tip	branch tip	not recorded	not recorded	SRP062488	134.56
SRR3169421	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169529	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169534	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169536	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169538	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169540	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182410	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182557	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182685	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182686	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182775	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182776	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182777	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182778	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182779	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182780	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182781	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182784	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182785	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182786	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182787	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182788	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182790	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182791	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182793	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182794	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00

Source: CnidoSite RNA-seq expression matrices (AGEMM_TPM, StringTie quantification over 48 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora gemmifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	0	not in this network	-
Negatively correlated	15	agem_s0134.g27.t1	-0.454238237004974

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora gemmifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →