Gene detail

Detailed information of agem_s0524.g1.t1 in Acropora gemmifera

Genomic Location: sc0000524_pilon:27091...43515
NR annotation: XP_029213552.1, dnaJ homolog subfamily C member 3-like [Acropora millepora]
Species Acropora gemmifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

agem_s0524.g1.t1

GCCAACACTGAAATGAACTGCGGTTCTCTCTGTCAGGACAGAAAATAAGCAAAACATTGCCGGCCAAAGTTGAAAATGCGTACTTTTAATCAGTTTTTCTCCCCTTTGCATTTGATTTTCTTCGGCCTGGAGCTGAGGATCATCGTTGTGTCCAGTAAATTGTCATCAGTTGAGATTGAAAATCATCTGGAACAAGGAAGGAAATTACTGTCCTCTGGACAGCTGAGCGATGCCTTGACTCATTATCACGCAGCCGTGGAGGGTGATCCTGATAATTTTTTGACTTATTTTAAAAGAGCAACAGTGTTTCTTGCGATGGGTCGCTCAAAGTCAGCGTTGCCAGACTTAGACAGAGTTCTTGAACTCAAGCCAGACTTTTTCCAGGCACGTCTTCAAAGAGGAAATCTTTTGCTAAAACAAGGACGGCTTGATGAAGCACATATTGATTATGAGGCAGTGTTACGCAAAAGTCCTGATAATCCAGAGGCACTTCAACAGTTAAGTGTAATTGAACCAATCAGAAGAGACATATTAGATGCCAAGAACTATATGAACATGGGTGATTATCCAACAGCAATAGAACTTTTAGGGAAGGCAATAGAGTTAGCTCCTTGGGATTCTGAACTAAGAATGATGAGAGCTGATTGTCATAAGCAAATGGGTGATTATATTGCTGCTATTTCAGATATTAAGCCTACGACAAAATTAGTTAGTGATAACACAGGAGCTTATCTTCAGCTCAGTGAACTCCATTACGACATGGGAGAGTTAGAAGATGCTTTAAGGGAAATACGAGAATGTCTCAAGTTAGATCCAGATCACAAGGATTGTTTTCCTTTTTATAAGAAAATGAAAAAGCTAAATAAACAGATGACTTCTGCTCAAGACTTAGTTAACAATGGAGATTATGAGGAAGCACTATCCAAACTAAAGCAAGCTCTCAAGACAGAGTCTCAAGTAACGTCACTTCTAAATAAAGTAAAGAGGCAGATGTGTCACTGTCACCTCAAGCTTCAAGATCCCAACGAAGCAATCAATCAGTGCAATGAAGCATTGAAACTGGATGAGAATGATGTGGATGCGCTTTGCGACAGAGCAGAAGCGCATATACTTAATGAAATGTATGATGAAGCTGTAAATGATTACCAACAAGCAAAAACTATTAATGAACACTTAAATAAGGTCCAGGAAGGACTTGAAAGAGCGCAGAAACTACAGAAGCAATCAAAGAAACGTGACTATTACAAAATATTAGGACTAAAAAGGTCAGCAACAAAGAAAGAAATATTGAAATCGTACAGGAAGCTTGCAGTGCAATGGCATCCTGACCAATATAAAGGAGAAGACAAGAAAAAAGCCGAGAAAATGTTTATTGATGTTGCGGCAGCTAAAGAAGTGCTGACGGACCCTGAAAAACGTGCTAAGTATGACAATGGAGAGGACCCACTTGATCCCGAAGCTCAGCAAGGCGGCGGCAATCCGTGGCAGCATGGTGGATTTCCTTTCGGAGAAGGATTTCAATTTAAATTTCATTTTAATTGAGACGTTATTATATTGTATATTTCGTAATAAAATTAGGAACTCTTTGGTGACCACACACATGTGGAAATAGTCAGTGATTTTGATATTACTGCGTAACACAACGCATCAGTATTGGCTAAAAGAAAACTCACCCCTCTTTTTGCAACGGGCAAGAATCAACCAAAACTAATTTATTCCCTCCACAGAGTTTTCCCTCGCTTTCTCGTGTCGGCTACATCTTCCATTTTCTTTGACGTGATTGGTTCGTTGGATGTGTATTGTTACAAAGTTAGTTTACAAGGGAATGCATTTTCAACCAAATCAAGTCAGACATCTTTTTGTGGAATTTATACATAATTAAACGGTTAGTTCTCTCTTCTATATGTTACTGTTTTATTTTCATCGAAATACACGGACAGCTTTGGTCCTTGTCATGTTACTGGAGGTTTGTTATCCAACTGTGTTCTTGTTATTTTCCTGAGCTTAAGAAGTTGCATTTGGCGCGTCGTAGGGTTGCTGTAATTTTATCTTCCTCTTCTTAATTTGGTGGTATTGGACATGTATTTATAACAGTGTAAGAATCCATCGAACTGTCCGCTATTTTACAATAAAAAAATTTACAACTT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13217	DnaJ homolog subfamily C member 3 OS=Homo sapiens OX=9606 GN=DNAJC3 PE=1 SV=1
Q5ZI13	DnaJ homolog subfamily C member 3 OS=Gallus gallus OX=9031 GN=DNAJC3 PE=2 SV=1
Q91YW3	DnaJ homolog subfamily C member 3 OS=Mus musculus OX=10090 GN=Dnajc3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006203 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12862 all species →	ANAPC5	Anaphase-promoting complex subunit 5	Repeat	Interproscan
PF00226 all species →	DnaJ	DnaJ domain	Domain	Interproscan
PF13432 all species →	TPR_16	Tetratricopeptide repeat	Repeat	Interproscan
PF12895 all species →	ANAPC3	Anaphase-promoting complex, cyclosome, subunit 3	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001623 all species →	Domain	DnaJ domain	Interproscan
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR026000 all species →	Domain	Anaphase-promoting complex subunit 5 domain	Interproscan
IPR051727 all species →	Family	DnaJ Homolog Subfamily C Member 3 Co-Chaperones	Interproscan
IPR036869 all species →	Homologous_superfamily	Chaperone J-domain superfamily	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44140 all species →	LD25575P	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005783 all species →	Cellular Component	endoplasmic reticulum	Interproscan
GO:0034975 all species →	Biological Process	protein folding in endoplasmic reticulum	Interproscan
GO:0051087 all species →	Molecular Function	protein-folding chaperone binding	Interproscan
GO:0051787 all species →	Molecular Function	misfolded protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09523	DNAJC3; DnaJ homolog subfamily C member 3	-	Chaperones and folding catalysts	ko03110	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of agem_s0524.g1.t1 across 48 RNA-seq samples of Acropora gemmifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

48Samples

3TPM > 0

1Conditions

57.3Max TPM

3.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
branch tip	48	3	3.04	57.33

Per sample · hover a bar for the full sample record

Show the sample table (48 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR2169558	branch tip	branch tip	not recorded	not recorded	SRP062488	57.33
SRR3223317	branch tip	branch tip	not recorded	not recorded	SRP062488	54.67
SRR3223319	branch tip	branch tip	not recorded	not recorded	SRP062488	34.00
SRR3169421	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169422	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169423	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169425	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169426	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169518	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169527	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169528	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169529	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169530	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169531	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169532	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169533	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169534	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169535	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169536	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169537	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169538	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169539	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169540	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3169541	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182410	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182448	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182557	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182684	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182685	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182686	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182775	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182776	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182777	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182778	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182779	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182780	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182781	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182784	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182785	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182786	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182787	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182788	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182789	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182790	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182791	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182792	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182793	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00
SRR3182794	branch tip	branch tip	not recorded	not recorded	SRP062488	0.00

Source: CnidoSite RNA-seq expression matrices (AGEMM_TPM, StringTie quantification over 48 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora gemmifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	12	agem_s0014.g62.t1	0.999999764234329
Negatively correlated	3	agem_s0028.g73.t1	-0.605162863309361

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora gemmifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →