Gene detail

Detailed information of alor_g12546.t1 in Acropora loripes

Genomic Location: Acropora_loripes_15:4216189...4229719
NR annotation: XP_029190529.2, calpain-7-like [Acropora millepora]
Species Acropora loripes · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

alor_g12546.t1

ATGGTAGACGTAAACGAACTTTGTGATGACGGCTATAGGTTAGCAATACAAGCGGTCGATTTAGACAAGATTGGCAGTAGAGAAGCTGCAGCATTCTTCTACATCGAGGCTGCAGAGGCTCTAATAAAAGCATTATCGTACGATCCCAGCTTGGACGTGAAACTCAAAGCTGAACAGTACATCCGGAGAGCAGAGGAACTCCGTGCATTGGAGGCACAAGCTTCAAAGCAAACCACAGTGCCCCTCAAGTCTTCACAACAGAATGGTGCTGAACGTGCAGAATTTCTCATAAAGCAAGCACTTAATGAAGATGAAAGAGGAAGAATTGAGGATGCATTGCCTCTTTACACTGATGCGGCAGAACTCTGCATGAAAACCAGCAACAGCCTACTAGATGATGATGATTTGAAGAAAAAGCTTCATTCTCTTGCAAAACAAGCAATAGAAAGAGCTGAGGCAATAAAAGGAATTTTGAGCAAGAAATCATCTCCCTCCAGACCTATCACTCATGCCATGCAAAACCTTTCCCTCAATTCCAAAGGGGATGCAACTCCGGGAGGAAGCACTGCTGACCGAAGACCTCAACTGACAGCCAAAGAACTTGAGGTGTTGAAGCACACGTCATATATAAATAGCAAACTATTTCCCCCATGGCTGGATAGTGATCTGAAAGAGAGATTTGCCTATCCTGATTATTACAGTGACAAAGATGGAAGGCTTCCGCTCTCGAAGAAACAAAAGGAACGCTTCTCCAAGTGGTTGAGGCCAACTGAGCTGTGTGACAACCCAGAAATGATTTATGCCATCTCCAGTTTTAGCATTAAACAGACAATTGTATCAGATTGTTCATTTCTCGCTTCATTAGCCATCAGTGCTGCATATGAGAGAAATTTCAAAAAGAGTCTCATTACAAGCATAATTTATCCACAGAATCGTGCTGGGAAACCTGTGATTAACCCTTCAGGAAAATACATGATTAAGTTACGCATCAATGGAATTTCAAGAAAGGTGATTATTGATGATACTCTGCCAGTGGGAAAAAACGGAGAGCTCTTGTGTTCTTACTCAAATAATCGTAATGAGATGTGGGTCAGTCTTATTGAAAAAGCTTATTTAAAGGTTATGGGGGGTTATGATTTTCCAGGCTCCAACTCAAGTATTGATCTCCATGCTCTCACAGGGTGGATCCCTGAACGCATGTCTATCAAACGAACTGATCCTGCATTCAATGAAAGTATGCATTTTGATCGATTGATGACTGGGTTGAGGAGAGGTGACTGCCTCATCACCATGGCAACAGGACCCATGAGTGAAACTGACGCTGACCGTGCAGGATTGGTGTCCACACACGCATATGCTTTGTTGGATATTCGCAAAATCCAGGGACATCGTCTTCTTCAGCTTAAAAATCCTTGGAGCCATCTTAGATGGAAGGGGAAATTTTCTGAGTTGGATTCGACAAACTGGACACCGGAACTTCAACGAGCACTTAACTACGACAGAAAAAGCGCTCTGCAATTCGACAACGGTGTTTTTTGGATTAACTGGGAAAGTGCAATGCAATTTTTTGATGTTGTTTACATGAACTGGAATCCTAAACTGTTTAAATATCGCTACGCTCTTCACTCGACTTGGAAGGCATTGGAAGGACCAAAGAAAGATGTCTACAATATTGGTGACAATCCACAGTACAAGTTAGAATTGATGTCATGTGACCGTGACACTGTGGTTTGGATTCTACTCACTCGACACATCACGCAAAAGGATGACTTTGCAGAGAACAAAGAATTTATAACTGTTCACGTTTATAAATCGGATGGCGGCCGAGTCTATTACCCAACTGACCCGTTCTTAGAGGGCACCAAAATCAACAGTCCGTTTTACTTGGCCAAACTGAATGCTCCCAAAGGAACCAAGCGATTTACACTTGTTGTTTCACAGTATGAAAAGACAAATACCATTCACTACACAGTCAAGGTTTTTTCATCAACTGAATTTCGCTTGTCCCCAGTTCCTGTCCCATACACTGTTGAGAAACAGGTGACTGGCGAATGGAAGGGCAAGCTCGCAGGCGGCTGTCCAAATTATCCATCGCATTCCAACAATCCAATTTATCGTTTACAACTCAAACCCTCATCACCGACAGAAACAGCCGAAGTGTTACTTAAACTACGTGGCCCAAAACAATTCTCAGTCGGTACTAATGTTCGATCTGTTGACCGTGCTTCCGATGGAAGGCCTGTGTTCAAGGTTGACTCTGACACTTACAGACCTGGCTTTTACGTACAACAGCTGAGCAAGATGCCCGCAGGAGTGTATGAGGTGATACCATCGACATTTTACCCGGGAAAAGAGGGACCATTCATACTTACGGTAGCAGCGAGCTCTGTGGGTTTATCATCACCAAATGATTGCCCGGTGAAATGTGAAGTACTATTTGATCCTGTCTGTGGCAGTAACAGACAAACTTATAAAACAACGTGTCATTTGAAAAGATACAACTGTTTTGAGAAACTGAGGGAGAAAGTGATTGTTGTTCACAGAGGAGAATGTTTGGCAAAGGAAGACGATGAAACGGAGCCCCACAAGTCATACAAGTGTATGAGAGTAGGAAGAGGGAAGTACTTAAATTGCTGA

Transcript

alor_g12546.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9R1S8	Calpain-7 OS=Mus musculus OX=10090 GN=Capn7 PE=2 SV=1
Q9Y6W3	Calpain-7 OS=Homo sapiens OX=9606 GN=CAPN7 PE=1 SV=1
A0FKG7	Calpain-7 OS=Sus scrofa OX=9823 GN=CAPN7 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003885 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04212 all species →	MIT	MIT (microtubule interacting and transport) domain	Domain	Interproscan
PF00648 all species →	Peptidase_C2	Calpain family cysteine protease	Family	Interproscan
PF01067 all species →	Calpain_III	Calpain large subunit, domain III	Domain	Interproscan
PF07648 all species →	Kazal_2	Kazal-type serine protease inhibitor domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036058 all species →	Homologous_superfamily	Kazal domain superfamily	Interproscan
IPR007330 all species →	Domain	MIT domain	Interproscan
IPR001300 all species →	Domain	Peptidase C2, calpain, catalytic domain	Interproscan
IPR002350 all species →	Domain	Kazal domain	Interproscan
IPR022683 all species →	Domain	Peptidase C2, calpain, domain III	Interproscan
IPR022684 all species →	Family	Peptidase C2, calpain family	Interproscan
IPR051297 all species →	Family	PalB/RIM13 Calpain-like Protease	Interproscan
IPR036213 all species →	Homologous_superfamily	Calpain large subunit, domain III superfamily	Interproscan
IPR036181 all species →	Homologous_superfamily	MIT domain superfamily	Interproscan
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR022682 all species →	Domain	Peptidase C2, calpain, large subunit, domain III	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46143 all species →	CALPAIN-7	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004198 all species →	Molecular Function	calcium-dependent cysteine-type endopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0004197 all species →	Molecular Function	cysteine-type endopeptidase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K08576	CAPN7; calpain-7	EC:3.4.22.-	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora loripes tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora loripes, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →