Gene detail

Detailed information of alor_g15376.t1 in Acropora loripes

Genomic Location: Acropora_loripes_3:484652...506731
NR annotation: XP_029211608.2, protein PTHB1-like [Acropora millepora]
Species Acropora loripes · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

alor_g15376.t1

ATGTCGCTCTTCAAGGCCAGAGATTGGTGGGCAACCTATGCTGGTAGTGACGAAGAATTTGACCAGGGATGCTTATGTGTGGCTAACATCGACAACAATTCATCACACTTTGATAAGATTATTGTAGGTAGCTATCATGGAATCCTCCGAATTTATTGTCCTAAGCCCCCAAGTTTTAAACCAGATGATCTTATGTTGGAAGTGCAGTTGCAACAGCCTATTTTGCAAGTTGAGGCAGGGAGATTTGTGTCAGGAGTGGATCAACTTCACTTAGCTGTTCTACACCCAAGAAAGCTTGCTGTTTACATTGTATCTGTTGTTTCTGGAGCTGTTGAACATGGTAATCATTATAGCCTTACAATGGTGTATGAGCACATTTTGGAAAGAAGTGCATTTAATATGACTTATGGCCCTTTTGGAAGAGTCAAAAGCAAAGACTTTATGTGTGTGCAGTCTACAGATGGGATGTTGTCATTCTTTGAACAAGAGAGTTACGCTTTTGGGAGATTTCTTCCTGGTTTTTTGTTACCTGGTCCACTCACTTATGTTGCAAAGACTGATTCTTTCTTAACAATCAGCTCTTCACTGCTTGTAGAATCTTACAAATATCAGACCCTAGCTGTTGCAACTGATGCTAATACTAAAGAAGACATTGGAAACAAAAAAGTATCAGGAAAGAAACTAACGATGGACTGGTCATTCAATATTGGTGAACATGCTGTCGACATCTTTGTTTTTAGCAGTTCAAATGCACCACTTTCAATATTTATTTTAGGTGAACGTTCATTGTTTTGTCTCACTGAGACTGGATCTATCAGATTCATGAAAAAGTTTGAATACAATCCTAGCTGTTTTCTTCCATATAATTCAGTCATAGAAGGAACAGTGAATGTTCTGCTGGCAACCTTCAATAAGACACTGATGGTTTATCAAGATGTGGCATTAGCTTGGGCAGCTCAACTTCCTCATATTCCAGTTGCACTTAGAGTGGCGTCGTTCCAAGAATTAAAAGGTGTTATAGTGACACTGGACGAGACTGGTTACCTCCACTGCGCTTATCTAGGAACTGACCCCTCAATGATGGTAACACCAGCTCCTGAATCCAGGGACATTAATTACGAAGAAGCAGATGCTGAAATGAGGGAACTTCAGAAAGAAATCAAGGAATCTACGTTAAGCTCAGAACTCTTACCGAGGGCACAACAAAGAGAAGATCTCCTTATTTCTGTTCACGTTCCTGCAACTTTAGATCCAGTACCTCAAAGCTCAGTCGACGATGGCGACGAAGAATTGTTTCCTTCGATTACTGTAACGGTCACACTCAAGTCGCAAGCCCCAAGTCCACTTGAAAATGTAGTCCTCAGTGTCATCTCCAGTCCTCCTCTCATGTGCAATAGATCTTCCATTGTGTTTCCTATAATCGGCGACAGGAGTGAACCCGTGTCTGCGGAAGTGTCATTCTACTCTCGTGGAGGATCCGTTCCCAGTTCATTGAAAGCTCAGGTCACAGCCACTTATCTTGCAAACTCAGAAGCCCCACGAGTCGCTCAAACAGATATCAACTTTCCCATGAATGTTGTCTGCAAATGCTGCGCGCCAATGAAGAATGCAAATCACAAGGTAACTATAGATACCAACAAACCTCCAGTAAATCTCGCCGAGATATTTTCCGATATGGTTAATGACGCCGTTATTCCGATGGCAGCTATCGGTATTCAGTACTATGGCGGACCCGTGGTGACCATCCTTGCTTCGAAAACGTCACAAAGATACAGAATCCAGTGTAATGTGTTTGAAGGAATGTGGCTTATTCTGTGCGAGCTGTGTAAGCGACTAGAGGACCATTACAAAAAAACCAAGGACTCCGTTCAATTTCGCGCATCGTTCATGGGCCCGCTGCCACTTCAGGAATATTACGAACTCATAGATGCACATTTCGAGCAACGCCTTAACCAGACTAAATACCGCGAGTTGTTGGCACAGCGGGCTCAACAATTTCGAACTATCCAAAGAAGATTGTTAGCAAGATTCAAGGACAAAACTCCAGCATCACTTGCAAACCTCGATACCTTACTGGATGGCACCTACAGACAGCTCTTAGCACTTGGTGAGGCCGAGGAGGAATGTGAACGATCCATTGAAATGGTTGCAAGCAACTTATCTTGCGGGACACGACTGTTGAATTTACTTATCAAATTATGGACCAACGTGTCTGACAAAGACTTCGAAATTCTTCAGACCGTTCTCTCCCCTGAAGTTTCGGAGTCGGAAGACCAGGGCTGGGAAGAAATCACCGATGCTGCTATTACTCATCTATTGCGGACCTGTCTGGCCAAGAGTGCCAAGGATCAAGCTGTGGGCTTGGCAGCAATGAAGATTCCCAAAGACACAAGCAAGTTGAAAAAACACCTTGCTTTAATGTGCGATAGATTGAACAAGGGAGGAAAGTTGGACCTATCATCGCAAACTGGTGAACCTTTTGTACAACAGCAACTGCAGAAGGCCGTGGCCCCCTTGGAACCACTCAGTGAAATGCAAGAAGAAGAAGATGAAACTGATGGTATGTCATCCACAACCGACGGAAGTCTCGCTTCGGAAATCTCCGACACTGAGTCGGTGATGAGTATGAACAACAGCAAGCCCACAGCTCGCTTACCGCAGCTCACTCATCCCAAGAAACTTCTACCCGACTTGAACAAACGAGTCCTAGTGAATCCAGGGTCTGAAGAGGAAAATATGGTGCTCAAAGGAATTGTTGATGCAGCCATAACAAATGGCGTATCTGAAAATCACGAACGAGCTCTTTAA

Transcript

alor_g15376.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6AX60	Protein PTHB1 OS=Xenopus laevis OX=8355 GN=bbs9 PE=2 SV=1
Q811G0	Protein PTHB1 OS=Mus musculus OX=10090 GN=Bbs9 PE=1 SV=2
Q3SYG4	Protein PTHB1 OS=Homo sapiens OX=9606 GN=BBS9 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005167 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF14728 all species →	PHTB1_C	PTHB1 C-terminus	Family	Interproscan
PF14727 all species →	PHTB1_N	PTHB1 N-terminus	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR028074 all species →	Domain	PTHB1, C-terminal domain	Interproscan
IPR026511 all species →	Family	Parathyroid hormone-responsive B1	Interproscan
IPR028073 all species →	Domain	PTHB1, N-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR20991 all species →	PARATHYROID HORMONE-RESPONSIVE B1 GENE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0034464 all species →	Cellular Component	BBSome	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K19398	BBS9; Bardet-Biedl syndrome 9 protein	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora loripes tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora loripes, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →