Gene detail

Detailed information of alor_g19344.t1 in Acropora loripes

Genomic Location: Acropora_loripes_87:274727...294449
NR annotation: XP_029184843.2, LOW QUALITY PROTEIN: DNA repair endonuclease XPF-like [Acropora millepora]
Species Acropora loripes · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

alor_g19344.t1

ATGATGACCAAGATGGCGGCTTTGATGTCAGAATACGAAAATGCGATGTTTTTAGAAGTTATGGACGATGACGGTCTCTTTGTTTCAGCCAAAGGTCTGAACATAGAAAGAGTTATCTCAAAATTTTTGAGTATTCATTGTGTCACAAGTGATCCTTCATCTATTTCCCTTGTCCTGGTGATAAACACAACATCTCAAGAGGAAGATTTCATATTGGATGAATTAAGATCTTCAGATGTGCCTTTGCCAAAAGTCATCACAACTGAATTCAGCTCATCTGAAAGGGAGTCTGTTTATCTAAGGGGAGGAGTTCTCTTTGTTACATCAAGAATCCTTGTAGTAGATATGTTAACCAAAAGGCTTCCTATTCATCTTGTAACTGGAATTGTCGTTTACAGAGCTCACAAGATAATAGAATCTTGCCAGGAGGCTTTCATTCTGCGTCTTTACAGGGAAAACAACAAGACTGGCTTTATAAAAGCATTCTCAGATAATGCACAGGCATTCACAAATGGCTTCTTTAAAGTTGAAAAAGTGATGAAGAACCTCTTTGTGAGAAGACTTTATCTCTGGCCAAGGTTTCATGCAACAATTTTTTCTTTCCTTGAAAAGCACAAGCCTGATGTAATTGAGCTTCATCTGCGTCTCACACCTAACATGCTGGCAATTCAAACAGCTATTCTTGATTTGATTAACACATGTCTTAAAGAACTGAAGAGAGCAAATCCAACGCTTGATCCTGAGGACCTTACTGTTGAGAATGGCATCAGCAAATCTTTTGACAAGGCTTTGATGTCTCAGCTTAACCCAATATGGCATCAATTGGGAAACAAGACAAAACAGTTGGTGTCAGATCTTAGAGTCCTGAGACTTATTTTACTTTACCTAACTCAGTATGACTGTGTTACATTCTATAACTTTCTGGAAACTCTAAGGGCCAGTCAACGTGATGTCAAGAATCAGTCTCTTTGGATGTTTTTGGATGCAGCAGACACCTTGTTTGTGCATGCCAAAGCAAGGGTGATAGAATGCACAGAGAGAAAACACAAGAAAAAGAAAGGAGAAAAACCAGAAGAGGAAGAGAAAGATAGTGAAGGTCTTGTACTAGAGGAAAGCCCCAAATGGAAACTGTTAGCTGAAGTCTTGGAAGAGATTGAACAAGATGATACCAAAAATGAAAGCAAAATTGGTCCTGGTCATGTGCTGATTGCAGCCTATGATGAAAGAACATGTTCACAACTTAGAGACTATCTCTGTGAGGGTAGTGAAGCTGTGTTGAAACGTCTTTATAACAAGATGCTTAAGAATCTGACAACAATAGGAGAACCCTCAGAGATAGTTTCCGTGGATGAAGGAAGCACAGGTGATGACCCAGTTGCAGAAAATCAGAGAACAACAGATTTTCTATCATCTCGTCGGCGTGCAGCGAAAACATCTGGAGAAGCTAATAATAAGAGGACTGGCAAAGGGAAAAAGCTGGCAGCAAAGAAAACAACACAGAAAGACGCAGTCAATAGTAATAGCTCTGAGCAAATAGTAAAGGTGTTTAAAGGATCAAGATCAAATGTCATCTTAAAGCCAGGAGATCAAGAGGACAAGGATAAGACAGAGGTCTCTCGCCAAATAACTCTGTTGACTTCTCGTGTTGTCATCATTCATCCTTTAACAGGGTGCAGTGATCGTTACAGCTTGTTACGTACCCTTAATGAAATTGAACCAAGATATGTCATTCTTTATGATGCACAAATGCAGTTCATACGACAGCTAGAGGTGTTCAAGGCCTCTAGACCTGGAATCCCTTTGCGAGTGTATTTTCTGATCTATACAGGTTCTGTGGAGGAACAGAAATATTTAACAACACTCCGTAGAGAAAAAGAAGCCTTTGAGATGCTGATTAAGGAGAAAGGAACCATGGTTGTCCCAGAGGAGCGAGAAGGACGCTCAGACGCTGCCATGTTGCTGAGTCGAGATGCATCCAAGGCTTCCGATGCTGCAAATACGCGAAAAGCAGGAGGACAAATTACTGACGACAAGGCAACAAGAAAGGTTATCGTTGACATGCGTGAGTTTCGCAGTGAACTTCCATCACTTATTCATCGTAGAGGAATTGATGTTGAACCTGTTACTTTAGAGGTTGGTGACTACATCCTCACTCCAGATATGTGTGTGGAAAGAAAGAGCATCAGCGATTTGATTGGTTCGCTAAACAATGGAAGACTGTACAATCAAGCGGTGGCAATGACCAGATTTTACAAGAAACCTGTTCTTCTTATCGAATTTGACCCTAACAAATCTTTTTCTCTCCAGGTAAAGTCTAGTCTGTCAAGCGAGGTTTCTGTAAATGACATTTCATCCAAGCTGACTTTACTTACACTTCACTTTCCTAAGTTGAGAATCTTGTGGTGTCACAGTCCGTATGCAACTGCTGAACTCTTTGATGATTTGAAGGCGAATCACCCAGAACCAGATGCTAGCACGGCAATGGCTGTGGGAACTGATCCCACTTTACCTTCATCAGAAATCACCTATAGCATGGGACCGCAGGACTTCATTTTGAAACTTCCCGGAATAAACTTCAAGAACTACAGGTTTGTGATGAAAAACGTAGCTAGCATCGAAAAGTTGTTCAAGTTGAGTGAGGGAGAACTCACAACCATTTTGGGCAACGCTACTAACGCCAAACTGCTATGGGAGTTTATTCACAAGGATAACACAACACAAGCGAAAGCCTCAACGACTTTTAAAAGCAAACGATGA

Transcript

alor_g19344.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q92889	DNA repair endonuclease XPF OS=Homo sapiens OX=9606 GN=ERCC4 PE=1 SV=3
Q9QYM7	DNA repair endonuclease XPF OS=Cricetulus griseus OX=10029 GN=ERCC4 PE=2 SV=3
Q9QZD4	DNA repair endonuclease XPF OS=Mus musculus OX=10090 GN=Ercc4 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002026 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02732 all species →	ERCC4	ERCC4 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006166 all species →	Domain	ERCC4 domain	Interproscan
IPR010994 all species →	Homologous_superfamily	RuvA domain 2-like	Interproscan
IPR006167 all species →	Family	DNA repair protein XPF	Interproscan
IPR047520 all species →	Domain	DNA repair endonuclease XPF, nuclease domain	Interproscan
IPR011335 all species →	Homologous_superfamily	Restriction endonuclease type II-like	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10150 all species →	DNA REPAIR ENDONUCLEASE XPF	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000014 all species →	Molecular Function	single-stranded DNA endodeoxyribonuclease activity	Interproscan
GO:0000110 all species →	Cellular Component	nucleotide-excision repair factor 1 complex	Interproscan
GO:0000712 all species →	Biological Process	resolution of meiotic recombination intermediates	Interproscan
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0003684 all species →	Molecular Function	damaged DNA binding	Interproscan
GO:0003697 all species →	Molecular Function	single-stranded DNA binding	Interproscan
GO:0006296 all species →	Biological Process	obsolete nucleotide-excision repair, DNA incision, 5'-to lesion	Interproscan
GO:1901255 all species →	Biological Process	nucleotide-excision repair involved in interstrand cross-link repair	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0004518 all species →	Molecular Function	nuclease activity	Interproscan
GO:0004520 all species →	Molecular Function	DNA endonuclease activity	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10848	ERCC4, XPF; DNA excision repair protein ERCC-4	EC:3.1.-.-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora loripes tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora loripes, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →