Gene detail

Detailed information of alor_g23771.t1 in Acropora loripes

Genomic Location: Acropora_loripes_4:5563337...5581391
NR annotation: XP_044164274.1, band 4.1-like protein 4 [Acropora millepora]
Species Acropora loripes · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

alor_g23771.t1

ATGGCATTGAGAGAGCATCTCAAGTCTTTTGTAGTAATTTACAGTATAAAGGCAGGACAGAGATGGCTAGATCCTTTGAAGCCTGTGGTAAAACAGCTGAAAGCTGGTCCTCCGTACTTGTTGTACTTTTGTGTCAAGTTTTATGCTGCTGACCCTTGTAGATTACATGAGGAACTAACAAGGTTACCTTGTGCAACAAATGTCCTTGCTGAACTCTCTTCATACAGCATTCAGTCTGAGCTGGGAGAGTATGATCCCAAGGAACATACTCAGGGTTATGTGTCGGAATTCAGGTTTATTCCCAACCAGAGTGAAGAACTGGAAGCCAAAGTTGGGCACATGCACAAGAAGCTTGGACAAATGGTACCCTCAGTGGCAGAGTTTATGTATCTTGACAAAGTCAAGTGGTTGGAAATGTATGGAGTTGATCTACATCCAGCTAAGGGAGATGATTTCGTGGAGTATTTTGTGGCCCTTAAGCCATCTGGGTTAGCGGTTTACAGGAACAAGACTCGAGTGGGTTCTTATCTTTGGTCCAAAATAGAAAAAGTGGATTTCAAAGGCAAAAAGTTCTACCTAACTGTGAAAGGAAAAGAGGATAGAGAATCTACCTTCAAATTTTATCTCCCAACCAACTCTGCTTGTAAGCATCTGTGGAAATGTTGTCTTGAGCACCACATATTTTTCAGACTGGATAAATCCAAAACTGTTCCTCGTCGTCGAAAAAGTATCCTTTTCCGCACCAGCTCATCTTACAGATACAGTGGGAGAACCCAAAAAGAGGCTTTAGAAGATGGAAAAAAGATTAAACGTTCTGACCCAGAAGTTTCAAGAAAACTCAGCAAACGCTATGAAAGGAGATCAAGTAGTGTATCTGGAGAAAAAGCTGTAAGTAGTGTTACAATCACTGCGACCAGTACATCACAAGTTCAGATACGACGTTTCAGCGAAACGGAAAAGCAAGGAGACTCTACAACCGTGCCTGTACAAAGTCCAAATGGAACTGTAACCAAGACGGACGGTGACCCAAGTTCCAGAAATGGCGCGAACACTGCAGTAGATGGCAGTGACAATCCGGGCCCTGCGTTGCCATGGGAACAATCTGCTCAATTGCAGGGCGGTTTATACACGCCAGCACCAGACTCACCTCATTCCATGAAAAGCACAGGGTCTGGTAGAGTCAAGAGATCCCCTAAGTTTCCAAGCCCGCATCGCCGATCAGCACCTAGCAGCGGCAGTGAAACAGACACACCTAGAAGAAGAGGTCGCAAAGCTTACTCTTCCGATGATGACACTGGCAGAAGACGGCGACGAAGATGTCGTCATCATCACCGAGGACACCATTCCGCCGAGTCAGGGAGTGATCGTGACTCATCTTACAGTAGAGACGAACGCAGGCGCAACAGATCGTCAAAAGACATGGAAGAGTTTCTTAAGATGTCAGACGCAGCGCCGTATTACTGGAATGAAAACACAAACAGGAAAGAACGAGGAAGTGGCTCGGAAGGGTCGCATCATCATCATCATCATCGGCACAGGCATCGTGAAGCCGATGCCAGAAGCGATGGTTCAGCATCGAAGCTCAGGCACAGTAAAGCCGCCAGTGAAGACGCCGAATCGGGAATGGTTCCAGCGCTGGATGTAATTCACTCGAGAGTATCTGTTGCTCGAGTCAAGGACGGAAGTGGCGGCAGGCACCGGCATCATCGTCATCACCGTCATAGTTACCTTGGTTACCAATCCAGTGAATCTGGGTACTCCGCTATGTCTGCGCCCACTGCACCTAAGAGCTCTCAGGTGTTGTTAGAGTTAGGCCCAGAACAAGTGTCCACACAAAGACATGTCCCCGTTTCATCGCAAGCAAGCCCCAGGATGACTGCAAGCCCCCATTCTCAATCCAGACCGGGGAGGGGAGGCTCATTGCCGAGAGAGGGAAGCCCCGATAAAGCCAGTCAATATCTTAAACTGGAGTACCCCAATGGAGTTATCATACACGACACACGGAATCAAGGACGTATTCCGAATCACGTTATGTACCAAGCTGCATTGCAGCTGAATGGAGCAACTCGTAGCTATCAAAGTACACAAGGGAAACACACAGCTAACGATTACATTGAAGTGGTGTCTGGTCCAGCAAAACGAGAGGAGCCGCCTCCGTACCACAGCCACAGCCCCTCTTCGACGATTAATCCCAGCAGCAAGTCGACGGTTCTCTAG

Transcript

alor_g23771.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O57457	Band 4.1-like protein 4 OS=Danio rerio OX=7955 GN=epb41l4a PE=2 SV=1
Q9HCS5	Band 4.1-like protein 4A OS=Homo sapiens OX=9606 GN=EPB41L4A PE=1 SV=2
P52963	Band 4.1-like protein 4A OS=Mus musculus OX=10090 GN=Epb41l4a PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000640 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF08736 all species →	FA	FERM adjacent (FA)	Family	Interproscan
PF00373 all species →	FERM_M	FERM central domain	Domain	Interproscan
PF09380 all species →	FERM_C	FERM C-terminal PH-like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014847 all species →	Domain	FERM adjacent	Interproscan
IPR019748 all species →	Domain	FERM central domain	Interproscan
IPR018980 all species →	Domain	FERM, C-terminal PH-like domain	Interproscan
IPR011993 all species →	Homologous_superfamily	PH-like domain superfamily	Interproscan
IPR000299 all species →	Domain	FERM domain	Interproscan
IPR019749 all species →	Domain	Band 4.1 domain	Interproscan
IPR035963 all species →	Homologous_superfamily	FERM superfamily, second domain	Interproscan
IPR014352 all species →	Homologous_superfamily	FERM/acyl-CoA-binding protein superfamily	Interproscan
IPR029071 all species →	Homologous_superfamily	Ubiquitin-like domain superfamily	Interproscan
IPR019747 all species →	Conserved_site	FERM conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23280 all species →	4.1 G PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005856 all species →	Cellular Component	cytoskeleton	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23962	EPB41L4A, NBL4; band 4.1-like protein 4A	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora loripes tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora loripes, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →