Gene detail

Detailed information of alor_g24840.t1 in Acropora loripes

Genomic Location: Acropora_loripes_148:31925...53411
NR annotation: XP_029202652.2, ras guanyl-releasing protein 3-like isoform X1 [Acropora millepora]
Species Acropora loripes · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

alor_g24840.t1

ATGACGAGCGGGCTTGAGACGAAAATCAACGGATCGGAGACGGAAAACGCCGAAGATACGCGAATAGGGAACGAATATAGACGAATCAAACGTGACCGGATATGCGTGGGGTTGGGATCAATTGTCTGGACGCTGAGTATTTGTCTTCACCTCGCGCAAAAAAAGTCAGAAGGAGACAAGTTGCTGACAATGGACGATAAACATGAAGAAGTCGATGGCGGTGTTGTCTCGGAAGAAGAACATGGCCGATATCCGCGCGCTGCATCACTCGACAAAATTGTTGACTTTTGTGCCGAAGAATTCGCCTGTGCAAAGAATGAAAATCAGAAGAAGTATAAAGCCAGCATCTGTGCTGCTGTTGGGTTTTGGATATCAAAGTATGGGTTAGAATTCAAGAAAGATGTGAAACTGGTCTCATTGTTGAATCAATTTTCTGAAATTGTTGACTGCAAAGGGGATAAATCAGTTATTGATAATTCCAATATCATGGCGGAAGTATTTCGAAATCGCACCCTCAGCGTACCAGCAGAAAATGAGCAAACTGAACCATCCATGGAAAGGAAAAATTCTATGGCTTTCAAAGACATCTCAGCATCAACCCTTGCAGAGCAACTTACCTACCTTGAATACAAGATGCTCCGTAGAGTACCATTTTCAGAACTGTGGACGTATGTCTCTACTGGCAAATTGAAGGAAACCACTTATCTTGAAAGATATGTAGCATTGTTTAATGGAGTGTCACGCTGGTTGCAAGGAATGGTATTAAACTGTGTAACACCAGAGGAAAGGGCTTCCTGCATAGAAAAGTTTCAGCAAACTGCCAAACATTTAAAGGAGTTGCAAAACTTCAATGGTCTGATGGCAGTGGCTGGGGGATTAACAAGTTCACCATTATCCAGATTGCATCAAACGCAAGACCTACTCTCACATGATTGTAAAAAGTTTCTGAAGATTCTTATGGAGTTTTTATCTTCTGATGGGAATTATGCTATGTACAGAAAAGCTTTGGGTGATGCCACCGGATTTGTCATCCCAATTTTTGTTTTTATAATTATTAATCTTTTATCAAAAGTGCATAATCTCTCAGAAAAATTAAACTGTATTCAGCTGAAGGATCTTATTGCATTGCACACTGCACTCCCTGACTCTGTAGATGGACACCTCATCAATGTACAAAAGATGATACGCTTAGCAACAATTGTTGCCCCTCTACTGCAGGTGCACACTTCCCAGCCACCTGTGAATCCAAATATGGAGCTTATCAAAGTGTTACGAGTGACACTTCAGACCAGACTCACAGATGAGGAGTTGTATGAACTGTCACTGGCTCGAGAACCAAGGAGTCATAGTCCATCTATGTCTTCAAGTTTGTCAAGTGATCACAGTGTGATGTTTGCTGACTGGGCCGCGGGATTACTACAACACACCACAAGTGACCCCCTGACGTCCGAGCGACATGTCTCCTCCATGGTTGAGGCTGTTTTCAAGATATATGACACAAATAAAGATGGCTCAATATCGGGGGAAGAGTTTGATGCAATTGCCACGAATTTTCCATTTATCGATTCTTTTGGAGTTCTTGACGTAAACAGTGATGGAGTCATCAGCCGAGAGGAAATGAGGAACTACTTTATGAAAGCAAACTGTCAAGAATTAACCAAAGGCTTTTCACATAATTTTCAAGAGTTCACTTACTTCACGCCGACATTCTGTGACCACTGCGGTGGAATGCTCTGGGGGATCATTAAACAAGGACACAGGTGCAAAGATTGTCATATCAACTGTCATAAAAACTGCAAAGCAGAGGTTGTAATCGGGTGCCGACGGAAACATCCCGAAAACGGCTCAGATAAAACACTTCAAAAATCAGAGATGGTCAGAAGCAAAGGGAAATATAAGAGCTTGAAAAAATTTCATAAACATCATTCAGAAGAAACGCTGAAGGCTGTTAATGGCGAATCTATCAACGTACCATTGGATCAATACAGGAGGCTTGTTAAAGCACAGGAGTGTAACGAAGCCCTCTTGTTGGAGAACGAACGTCTTCACAGCGAATTGAAAGAGGCTACGCAAAAGTTGAGCGTGTTGCAGAATCAAGTGAATGCTATGAAGCAAAATACTGTGACATTTATTCTGGAACAAATGGACACGCTTAAAATGCAGAAAGTAACAGAGGTATAG

Transcript

alor_g24840.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A4IJ06	RAS guanyl-releasing protein 1 OS=Xenopus tropicalis OX=8364 GN=rasgrp1 PE=2 SV=1
Q8IV61	Ras guanyl-releasing protein 3 OS=Homo sapiens OX=9606 GN=RASGRP3 PE=1 SV=1
Q6NTL4	RAS guanyl-releasing protein 1 OS=Xenopus laevis OX=8355 GN=rasgrp1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002655 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00130 all species →	C1_1	Phorbol esters/diacylglycerol binding domain (C1 domain)	Domain	Interproscan
PF13499 all species →	EF-hand_7	EF-hand domain pair	Domain	Interproscan
PF00617 all species →	RasGEF	RasGEF domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR023578 all species →	Homologous_superfamily	Ras guanine nucleotide exchange factor domain superfamily	Interproscan
IPR008937 all species →	Family	Ras-like guanine nucleotide exchange factor	Interproscan
IPR001895 all species →	Domain	Ras guanine-nucleotide exchange factors catalytic domain	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan
IPR002219 all species →	Domain	Protein kinase C-like, phorbol ester/diacylglycerol-binding domain	Interproscan
IPR046349 all species →	Homologous_superfamily	C1-like domain superfamily	Interproscan
IPR036964 all species →	Homologous_superfamily	Ras guanine-nucleotide exchange factor, catalytic domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23113 all species →	GUANINE NUCLEOTIDE EXCHANGE FACTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005085 all species →	Molecular Function	guanyl-nucleotide exchange factor activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007264 all species →	Biological Process	small GTPase-mediated signal transduction	Interproscan
GO:0007265 all species →	Biological Process	Ras protein signal transduction	Interproscan
GO:0043547 all species →	Biological Process	positive regulation of GTPase activity	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12362	RASGRP3; RAS guanyl-releasing protein 3	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora loripes tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora loripes, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →