Gene detail

Detailed information of alor_g25686.t1 in Acropora loripes

Genomic Location: Acropora_loripes_35:266409...284750
NR annotation: XP_029213159.2, kinase suppressor of Ras 2-like isoform X3 [Acropora millepora]
Species Acropora loripes · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

alor_g25686.t1

ATGTCGTCGAATGGACTGACAGTTTCGAAGGTCCTCGAGCAGATCCAAATGGTTCAAGGCATGATAGATATGAACGCTTCTAGTTTGAACAGCCTGCGAACTCAGTTCTCCACCAACAGTGATCTAATCCAACAGGAAATTCGCACCCTGGAGGGCAAATTGGTTAAGTTATTTTCTCGTCAGTTGGTGACGAAGCAGAAATGCGGTGAAGATTGGAATCATTGTGAGAAATTGCGTTATTATCCGAGACTAGAACAATGGCTTCAAGTTGTGGGAATCAATGAAGAGGCGATCAAACAGAGCTTAGAAGAAAAGTGCAACACCATAGAGGGTTTGTTATCCCTTTCTGATGAAAAAGTAAGAGCTGTTCTGGAAAACTATGCAGATGGAAAGGAAGAAAGTCGCAGATTGATAGCTGCATTGAAGCATCTTCAGGCTTACACAGAGCGCCAGAAGCAAGGTCACAAAGACAGCACTTCAGACATATACTGGGATTCGTGGGACACTGGAAGGACTAGAGAAAAAACAGCATCAACGTCTTTGTCAGAGCGATCGTCGCGGTCATCAGTTACTCTGGACAATGAGGTTCTCTCGTCGTCGCCAAGCTTGGACGCTAATAGTGAGGGATCCAGGCTATCAACTCTGTCCTCAAGCGACACAGACACTGCACCCAGTTTCAAGCAGCACAGCCCATTGCCAGCTCATTTCATAGTGCGCAACGGCAGCCCTTCTTCGCCACTAAAGAGGAGTGTTTCTGATGAAGTTAATCTGGCTCACAGAATTCACATCACCAATGAACACGCGAGTGCGACGGTCGGCAAGAAGCGTGGAAGGGGTAAACTTGAGCCGATCGTACCTGGCATGACAATACAGATTCCTAAGAGTGTCAGTGGGGACATCTGTCAATCGGACTCTGAATATGATCATAATTCAAGTTGTCACACTCTTGATTCTTCATCTCCATCAAGGATAACGCATTATGGTATGCAGCACACAATCAAACACAGGTTTTCACAGAAGACCTTTTTGGCGAGCTTGGCCTGTGACCATTGTCACAAGATCCTTTTAGTCGGCGTCAAGTGCAAGCACTGCAGAATGAAGTTCCACAAGAAATGTGCCAAACGCACCCCGTCTCTTTGCCAATTGCCGAAGGAGTATGGGGATTTCTTTGTGAGTCAGCTGCGGCGAGCTTGGGAATATCGTTCATTGCCTAGTACACGCTCCGGATTCAAGCGAACCAATTCGGAACCTTCCAGCATAGCACTTCAAGTGGAAGGGTTAAAACAGAAGGGCAGAGCCAACCGCAGCCATGGCGACTTGAATTCAGTCGACCAGAAGTGCAACAGTGAGATTCCCGTACAGTTCAGCCACAAGGGCAGTGCCACTAATGGCGATTCCGGTTCGACGTCATCGTCTACGTCATCGCCACCGGCATCGCCGCTTCCCAGTGCTGCCTCGGTGTCCACGAGCACTTGCTTGTCGGCTCAAGAGGAGCTAGACCAGTTCCCAGGCTCACATTTTCCCTTCTCAGATGTTTCAAGAAGAATGTCACCCGCCCAAAGCAACGAAATGATTGACTCTACAAGCACACTGACGAGAACAGAAAGTGTCAAGTCGCAGAAGAGTAATAACACAACGGCTAGCAATGACTCGTTACAGACTCTTTCTGGAGACGATGCCCCTGGTGTTGATGTTTTAGGCAAACAGATCTCGGATTTTGATTCTCACACCAGAACGTGGGGACGTCGCGAGCAAAGAGGCAGTTTAATGTCTGAGTGGGTGATACCGTTTGAAGAGCTGGATATCACGTGGAATCCGCTTGGTGCTGGAAGATTTGGCAAAGTTTACAGGGGTCACTGGCACGGCGAAGTCGCTGTGAAGATCATTGAGATCGAAAACCCAACGGAAGAACAGTTGAACGCGTTCAAATTTCAAGTTGGTACATTCCGCAAGACCCGGCACGAGAACGTGGTTCTTTTCATGGGAGCCTGTATGGATCCACCTAAACTCGCCATTATCACCAGTATGTGCCGGGGATTTTCTCTTTATACTCACGTGCATGTACGGAAGGACGACTTTCACCTGCCAAAAATTTCCCAAATTTGTACCCAAATTTCCCAGGGAATGGGTTATCTTCACGCTCGAGGAATCGTTCATACTGATCTGCGGTCGAAGAACGTATTCCTTGAGTCCGCCAATCGCGTGGTCATCACAGACTTTGGTTTGTTTAGCGTGGCTGGCCTGACCACCAAATCAGCGAGACCTGGCTGGCTGTTAATTCCCGAGGGATGGTTGCCATATTTGGCGCCGGAAGTAATTCGATCTCTCACAACCCAACAGGACGCACCGGATTCGTCCCAGTTCACCATGGCAACGGATATGTATGCTTTTGGGACTGTGTGGTATGAGATGTGCATTGGTGCGTGGCCTTTCAGGAAGCAAATTCCCGAGGCGATAATATGGCAGGTTGGAAAAGGAGTCAAGCCTCCACTTACCAATGTGGATGTACCTCGAGAAGTCAAGGACACCTTAACTGTTTGCTGGGCGTATGATCCCGAAAAACGGCCAACATTTAGCAATCTGCTGAGAACGCTTGAGAGACTGCCCAAACAACGACAGAGACTGCGGAGAAGCCCTTCACAGCCGTGAGGAGCCATCCACAATAAAGCAAAGCTTAAGTTGACGGCCAAGATGAAATAG

Transcript

alor_g25686.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q61097	Kinase suppressor of Ras 1 OS=Mus musculus OX=10090 GN=Ksr1 PE=1 SV=1
Q6VAB6	Kinase suppressor of Ras 2 OS=Homo sapiens OX=9606 GN=KSR2 PE=1 SV=2
Q3UVC0	Kinase suppressor of Ras 2 OS=Mus musculus OX=10090 GN=Ksr2 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001449 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13543 all species →	SAM_KSR1	SAM like domain present in kinase suppressor RAS 1	Domain	Interproscan
PF00130 all species →	C1_1	Phorbol esters/diacylglycerol binding domain (C1 domain)	Domain	Interproscan
PF20406 all species →	SAM_KSR1_N	Kinase suppressor RAS 1 N-terminal helical hairpin	Domain	Interproscan
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR046933 all species →	Homologous_superfamily	Kinase suppressor RAS 1, N-terminal helical hairpin superfamily	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR002219 all species →	Domain	Protein kinase C-like, phorbol ester/diacylglycerol-binding domain	Interproscan
IPR050167 all species →	Family	Serine/threonine-protein kinase	Interproscan
IPR046349 all species →	Homologous_superfamily	C1-like domain superfamily	Interproscan
IPR025561 all species →	Domain	Kinase suppressor of RAS, SAM-like domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR046861 all species →	Domain	Kinase suppressor RAS 1, N-terminal helical hairpin	Interproscan
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23257 all species →	SERINE-THREONINE PROTEIN KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0007265 all species →	Biological Process	Ras protein signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for alor_g25686.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora loripes tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora loripes, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →