Gene detail

Detailed information of alvinactis_v1_g26034 in Alvinactis idsseensis sp. Nov.

Genomic Location: chr_14:29173...37365
NR annotation: XP_020893377.1, E3 ubiquitin-protein ligase RMND5A [Exaiptasia diaphana]
Species Alvinactis idsseensis sp. Nov. · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

alvinactis_v1_g26034

ATGGATGCCTGCTTGAACGTAGAGAAAGAACAAGAAAAGGTTTTAAAGAAATACAAGGGTCTTATCGAACATACAGATGTAACACTGGGTGACTTGTGTAACCATATATCTAATCTACGGAATGAAATCGTCAATTCCAATCAAGAAGATCTCTCACCACTGCAATGCCAAGTGCTTACACAGTCTGCCAAGAAAGTTAAAGATACAGTGTCTAGAGTAGCTATTGAACATAAAGAGCTACACGGTGGCATATCAAAGATTGGAAAGGCTATAGATAGGAATTTCATTGCCGATAATACAGCTTGTAGTTATAATGGCGTATTCGAGGGAGAGAAGTCTGTACTCTTAAATGAAGTGATATGTGAGCACCTGTTACGACAAGGACGGTTGGATATTGCCGAAGAGTTAATCAAGGAAGCCAATCTTCATTTGGACAGTTCTAAAAAGGAGCCTTTTCAAGAACTAAATAGGATCCTTGAAGCTTGTAGGTGTAGAAACCTTGATCCAGCGCTAGACTGGGCAAAGGCACGTCATTCACAATTAAAGGAAAGAGGGAGCTCTCTAGAGTTCAAACTTCACAAACTTAAATTCCTTGACTTACTGAGACAAGGCAATCAAGAGCAGGCACTCAAGTATGCTAAAAACTTTGCTGCATTTGCTTCAGTTCACTCGAAAGATCTCCAACAGTTAATGGCATGTCTTTTATACACCAAAACTGGCATAGAAAACTCTCCTTACTCCTATCTCCTTGATCCAATTCACTGGATAGACATCTGTGACCTGTTTGCCAGAGATGCCTGTGCACTACTTGGGCTGTCTCTGGAAAGTCCTCTACAAGTGTGCATTACTGCAGGATGCATTGCACTTCCATCAATACTACAGATTAAACAAGTTATACAACAGAAGCAAGTACCAGGAGTATGGAGCTCGAAGGATGAACTTCCGGTTGAAGTTGATCTTGGACATCAGTATCGTTACCACTCCATCTTTGCCTGCCCTATCTTACGGCAACAATGTTCAGACACAAACCCACCTGTACGATTAACATGCGGTCATGTGATATCGCGAGACGCACTATACAAACTAACGAATGGAAACAAATGTGCTGACACCCTTGGGACCAAAATAGCTATGACTCCTCGTGTTAATGCAATATCTTTACTGGAAGATAACTCTAGTTCTTTACCGCCTTCAAAAAGGTTTAACTTTATAGCAGACGCGGTAGAGACAGTACAAGCGGCCGTTGTGTACATCGAGGTCACAGACGGGAGAGTTGCGGGAATGTTTGGATACCACGCGGGACCTACCAGTTCTGGTTCGGGATTTTTTGTCACTGAAGAAGGGATGGTTCTTACAAACGCTCATGTTGTTGCTAATGCTATAGACGTTAGTGTAAAGTTAAGAGATGGACGGCAATTTAAGGGTGTTGTTGTGGATATTGACCCTGTAAAGGATTTGGCTGCGATTAAACTCAATGCTTCTCAGGTTGGTAACTCAGGCGGTCCTTTGGTCAATTTGGATGGTGAGGTCATTGGAATCAGTGCCATAACAGTAAAGTTTGCTGCAGGGATATCTTTTGCAATACCAATAGATGCAGCTAAAGAGTTCTTAAAGGGAGCACAGAGCAAGAAAATCTTCACGAGAAGTGGTCCACAGAGGATCCTCAGATCAACTCAACGCTGGTATATTGGGATCAACATGCTCACTCTGTCACCCCAAATTCTTGAGGAGCTTCAAAGAAGAGACTCTAATTTTGAGAACCTCAAAGGAGGAGTGTTTGTGGCTGGTGTGAATCATAGATCTCCTGCTCATGTGGCAGGACTGATGTCTGGTGACGTCATCACAAAAATCAATGGTCAAAACATTGCAACATCTAAGGATGTATTTGAATATGTGAAGAGGGGAGAGACACTGAAAATGAATGTTCAAAGAGGAACCCAAACTGTTTCTCTAACTGTTCAACCACAAGTAGTGGGTTAA

Transcript

alvinactis_v1_g26034

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q640V2	E3 ubiquitin-protein ligase RMND5A OS=Xenopus tropicalis OX=8364 GN=rmnd5a PE=2 SV=1
Q9H871	E3 ubiquitin-protein transferase RMND5A OS=Homo sapiens OX=9606 GN=RMND5A PE=1 SV=1
Q80YQ8	E3 ubiquitin-protein ligase RMND5A OS=Mus musculus OX=10090 GN=Rmnd5a PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006522 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13365 all species →	Trypsin_2	Trypsin-like peptidase domain	Domain	Interproscan
PF10607 all species →	CTLH	CTLH/CRA C-terminal to LisH motif domain	Domain	Interproscan
PF13180 all species →	PDZ_2	PDZ domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR045098 all species →	Family	Fyv10 family	Interproscan
IPR006595 all species →	Domain	CTLH, C-terminal LisH motif	Interproscan
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR009003 all species →	Homologous_superfamily	Peptidase S1, PA clan	Interproscan
IPR013144 all species →	Domain	CRA domain	Interproscan
IPR001940 all species →	Family	Peptidase S1C	Interproscan
IPR044063 all species →	Domain	Gid-type RING finger domain	Interproscan
IPR024964 all species →	Domain	CTLH/CRA C-terminal to LisH motif domain	Interproscan
IPR043504 all species →	Homologous_superfamily	Peptidase S1, PA clan, chymotrypsin-like fold	Interproscan
IPR006594 all species →	Conserved_site	LIS1 homology motif	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12170 all species →	MACROPHAGE ERYTHROBLAST ATTACHER-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0034657 all species →	Cellular Component	GID complex	Interproscan
GO:0043161 all species →	Biological Process	proteasome-mediated ubiquitin-dependent protein catabolic process	Interproscan
GO:0004252 all species →	Molecular Function	serine-type endopeptidase activity	Interproscan
GO:0006508 all species →	Biological Process	proteolysis	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for alvinactis_v1_g26034.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Alvinactis idsseensis sp. Nov. tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Alvinactis idsseensis sp. Nov., and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →