Gene detail

Detailed information of amic_s0002.g418.t1 in Acropora microphthalma

Genomic Location: sc0000002_pilon:5461622...5474324
NR annotation: XP_029184371.2, RNA-binding protein 39-like isoform X1 [Acropora millepora]
Species Acropora microphthalma · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amic_s0002.g418.t1

CGTGTCTCACGCCATCTTGGAAATAGAGGGAGAATTTTCCCTTGTTGAAGAATAGTAGTGGAGACGATTTTGATTGTTTACCAGAGTTTTCGTGACAATTTGATCCACATTAACCATGACTGACGACTTTGATGTAGAGGCAATGCTTGAGGCACCTTACAGAAAAGAGACTCCACCAGCTCAGAATGGAAGAAAGAATGAGTCAAAGAGGCAAAGTGATGTTGAAGAAAGAAGAAGAAGAGGTCGTCGAAGTCGCAGTAGGAGTCGTGACAGGACTCGCCGGCGACGTAGTCGAAGTGGTAGTCAAGATAGGTCTCAGAAGCGAAGGAGCCGCTCTGGAAGCCGTGACAGATCGCGTAGACGAAAAAGCCGCTCTGGAAGTCGTGACAGAAGGCGTAAACGTCGTAGCAGCAGTGGAAGCAAAAGCCCTTCTAGAAGTCCAAGTCGTAGAAGTGCTGCCAGAAGGGGATCAAGACACGAGAAACGTAATGAAAGTGGCAGTCCAAGCCCTGAAAGAAAAAAAGGAGCTGATGTGGAGACAAAGGAAGCTAGTCCAGCTGAACAACATTTAGAAAGAAGGGAATTGAAACCTGCAGAGGATATAACACCAGAAGAGAGAGATGCTCGAACAGCATTCTGTATGCAGCTGGCAAGGAACATCAGACCCAGAGATCTAGAGGAATTCTTTTCAAAAGTGGGACAAGTGGCTGATGTACGAATCATATCAGATCGTAACTCCAGGAGGTCGAAAGGTATAGCCTATGTCGAGTTCACAGACAGATCTGCCGTTCCCTTGGCTATTAATTTGTCTGGTCAGAAGCTTTTGGGTGCCCCTATCATGGTCATGCCAACCCAAGCAGAAAAGAACCGAGCAGCCGCAGAAGCTGAAAGACTCAAAAACCCTCCTGGGCCTACAAGACTGTATGTTGGGTCACTACACTTCAACATCACGGAGCAAATGATCAAAGCAATCTTTGAACCATTTGGCACTGTGGAAAGTGTGCAATTGATTTATGACTCTGAAACAGGAAGATCAAAAGGCTATGGCTTTCTTCAGTTCAAAGAAGCAGAGGCTGCTCGGCAAGCTATGGATCAAATGAATGGTTTTGAACTTGCGGGAAGACCCATGAAGGTTGGGCCTGTCACAGAGAGAGGAGATTCATCATCATATTCATTCCTTGATGATGAGGAGTATGAGAAAGGTGGTGTGGAATTGAACTCTACAGCCAGGGCTGCCCTTATGGCCAAGTTATCCCAAGGACATTCAGCAGGACTGTCCGTTCCAGGTGTCCCTCCACCAGTAGTTGGGGTGCAACAAGCATTGGCAGCACCAGTGGCAATTCCACTTCCTACATCTTGCATTTTACTGCTCAATATGTTTGATCCCCAAAAGGAGAAAGACCCTGATTGGGATGCAGACATCAGAGATGATGTATTAGAAGAATGCACTAAATATGGCCAAGTTTATCACATTCATGTGGACAAATCGTCCAACCAGGGCGCGGTGTATGTAAAATGTAGCAACGCTGAAGTAGCCGCAAGTGCATCAAAAGCTCTCCATGGAAGATGGTTTGCCGGGAAGCAAATCATTGCAAGAGCTGTACCCCTCGCAAATTACCATTCTATGTTTCCTCAGGCCGTCACCATGACGAAACCATTGCAACCATCCTCAGTTTGAACCACTCAACAGTTGTCTTAAGTGATATTTTAGTTGCTGCTTCCATCGTCTGTAAATAATTTAAATCAAAAGGAAGATGGCAGTCGCAAATTCATTAGGGCAAGCCGGTAAATTCAACTCGGCCAGCCAGGATGGTTTAAGGGCACAAGCTTACAAACACTTTCCTTGTTGAATTAAAGAAATGGAACATACGCTGTCACCTTCGGGTAAAGTAAGAGTTCATGCAAACCATTCTTATATGGACAGCGATTCTGTTGTACTCTGTCTAATTTACGCAGTTTTCGTTTCGTTTATTTGAGTAGAATTAGAAGCTATTATATGCTGAGCTTTAGATTTAAGTAGTCCGTGAAATAAAACATCCTTGGGTATGTGAACTTGACATCCGATTTTATTAACGTTTTCTGGCAATGTCCTTCACTTTTTGTTCGTTTTCCATCTACCCCAATGAAAGTGCTTTAAATAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5RC80	RNA-binding protein 39 OS=Pongo abelii OX=9601 GN=RBM39 PE=2 SV=1
Q14498	RNA-binding protein 39 OS=Homo sapiens OX=9606 GN=RBM39 PE=1 SV=2
Q8VH51	RNA-binding protein 39 OS=Mus musculus OX=10090 GN=Rbm39 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003764 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00076 all species →	RRM_1	RNA recognition motif	Domain	Interproscan
PF15519 all species →	RBM39linker	linker between RRM2 and RRM3 domains in RBM39 protein	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000504 all species →	Domain	RNA recognition motif domain	Interproscan
IPR003954 all species →	Domain	RNA recognition motif domain, eukaryote	Interproscan
IPR006509 all species →	Family	Splicing factor, RBM39-like	Interproscan
IPR035979 all species →	Homologous_superfamily	RNA-binding domain superfamily	Interproscan
IPR012677 all species →	Homologous_superfamily	Nucleotide-binding alpha-beta plait domain superfamily	Interproscan
IPR029123 all species →	Domain	Splicing factor RBM39, linker	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48036 all species →	SPLICING FACTOR (PAD-1), PUTATIVE (AFU_ORTHOLOGUE AFUA_1G15810)-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006397 all species →	Biological Process	mRNA processing	Interproscan
GO:1990446 all species →	Molecular Function	U1 snRNP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13091	RBM23_39; RNA-binding protein 23/39	-	Spliceosome	ko03041	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora microphthalma tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora microphthalma, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →