Gene detail

Detailed information of amic_s0012.g111.t1 in Acropora microphthalma

Genomic Location: sc0000012_pilon:1529519...1543538
NR annotation: XP_015773871.1, PREDICTED: tumor necrosis factor receptor superfamily member 16-like isoform X3 [Acropora digitifera]
Species Acropora microphthalma · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amic_s0012.g111.t1

CGACATCATCATATATAATTTTCTTTTGCCGAGGAAAGCGTGGTTGAGAATGCTAGCAATGGATCGGAGAAAGCGAAGCGTAAACATCATCTGTGTATGTGCTCTCCTCTGGTCCTGTGTTACTGTTCTCTCTTGTCCTGAGGGGACCTATGAATGGAAAAATGGTTTGTGCTGTAATCTGTGTCCACAGGGAACCCACTTGATATCGCCTTGCAATAACAAGTCACAGATTTCCTCCTGTCAACCCTGCCCGTCACAAACCTTTATGGACAAAGAAAACAATGAAGCAAAGTGTTTGCCTTGCACACGCTGTGAACCAACACAGGTTGCATTGTTGGAGTGCAGCGCGAACCAGAATCGGAAATGTGGATGTGAAACAGGAACATTTCTCGAGCTATCCTTTCTCATCTGTGTGAAATGCAAAAAATGCCCGAGAGGAGAGGGTGTGGAGTCTAATTGTTCAGGATCTTCGGACACAAAATGTGCGCCTTGCGTGGAGGGGCGCACGTTCTCAGACGTTGAGTCCTTTACAGAACCTTGTAAGAATTGCACGCAATGTGATGGTATGGCAATGAATGATGAATGCAGTTTATCACGAGATACCATATGTGAAACAGCCTATGCAACTGTTGCGCCAACGACAACATCATCGACAATTTTATCGACAACTTCTTCAATCTCCAGTGTATCTCTACCGGAAGCTGGTACGGTCTATGCAGTTGAGGAGGATGCAGTTAAAACTGGCCAGGAAGATTCGGACGTCATATCTCCACAGTTTAGAATAGGCCTTTCCTTAGCCCTTGGTATTCTTGGATTCTCCGTTGCAGTCATTTTGGTTGCTCTGAAGTTCTTTTATATCAAGAAAATACGGAATGATAACGTTTCCGTTTGCTATCGTACAGAAGGAACTGTGGTCACAGGAATAAATTTTCCCGTAGCAGCAACATCCAGTTCCTTGCGTGGACTGCGCGGAAGGAAGACGACGAGTGGGAGGACCTCTAATTGCCACGGCCGAGAATCAGACTCACAAGGGAGTAACTGCTCGCTACAGGGGGTCAGCATCGGAGGAGGCAGTGGAAAAAGCAAGACGTTGGTTCGCGATCTGCCCGGTCACATTTATTTTGAGTTAGGAAGATTCCTTAACCCAAAGTCTCGCAATAACTGGATGATACTTGCGGGAAGATTGGGATTCAGTGACAGCGATGTTAAAAACTTTGATACTTATCCTGACCAGGCGACACAGAGAGTTCTGGATGAGTGGGGACAGAGAGAAGGCTCCACGGTTAATGCTTTAATCTGTGAGTTGAAAGAAATGAAAAGAGACGATTGTGTTCAGGTCCTTAAAGCATGGGAGAGCTGAAAGCTTCGTCATTTCAACCAATTACGGTGAAAAGTTGGTAGAGGTGAGATAACAGACGAGACAAGCTGTGCTTCATAACTTAACTTAAGAAACCGACACGCTTTCCGGCGCTCGCGAAATCGTCGGTAAGGTTCGTGAGAACTTTGGATTCTCAGCATGACACCTGACGAGAGATGCTATAGACCTAATTAAAAAATATATATTTAATTGGGCTATGTAGTACATTTGTGTTAGAGGCAATATGTAGGATAGAGGCGATTTTTGTCTGATTCAACCAAGACCCTTGCCATACAGCGAATGCATAAATGGCAGCTTAATTAATTATTTATTTTCACGATTCAATTAAATTTTAGTTAGTCGTATTTCATCCATCAATCACGATAACCGTCGTTACTCGGATAAAAGCCCTATGTGAGGTGCGAATTATGGAGCCTATTCGAGTTAAAAAATATCGTCGCCGACTTGAACAAAGAAGTAAGTAGTCTTTTCACTGATCAAAGATACAATGTTGTTTAAGAACCTTCAAGTTCTAGATGCTGAGAACAGTTCCTTCAATAGGTTGCTCTCATCGATGATTATATGCACAATCGCGTAAGAAATTTGTTTGCTGTTTTTGTCTTTGGCATCACCGTCAAAAGCCGGAGAAAGACCTTGTTCTTATTCTTCAAGTTTTAGTTAAGGTTTAGAGTGAATATTGCAACTTAAGTCCCAAAGGAGCAAATGCCAAAGTAAGTTGTCTATTTAAATAATTTGTTCGTATAAAGTAAGTCAGTGTTGACAAATAGAAGTAGAGAGAGTATATTTGTAAGATGATATTACGCATAGATTTGTATAAGAACTAAGGTCGCATTCATTTGCAAAGATGATTGATTCGCAAATAAGTTACCAACTCCCTTTATAAATTTAATTTTTCTGGTTGGAAATCTGGTCCCGACATGTTCAAAGACTCGTCAATTGGAAGTTGTTGTTAGAAAAATTGTCGTTTTCAATCATATGATTCAATTTATATTGAAGCAGTAAGACTGTACCGTAAGTATTTGACTCCCTTTCATCCAAAATGTTGTTGTTTATAGCAGCTTTTAGTTCAAATTTGGTGATGTAAAGTCACAATAAAAGTAATTTATTGAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q93038	Tumor necrosis factor receptor superfamily member 25 OS=Homo sapiens OX=9606 GN=TNFRSF25 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000860 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00531 all species →	Death	Death domain	Domain	Interproscan
PF00020 all species →	TNFR_c6	TNFR/NGFR cysteine-rich region	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR022325 all species →	Family	Tumour necrosis factor receptor 16	Interproscan
IPR011029 all species →	Homologous_superfamily	Death-like domain superfamily	Interproscan
IPR000488 all species →	Domain	Death domain	Interproscan
IPR001368 all species →	Domain	TNFR/NGFR cysteine-rich region	Interproscan
IPR052302 all species →	Family	Neurotrophin receptor-related death domain-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46605 all species →	TUMOR NECROSIS FACTOR RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005035 all species →	Molecular Function	death receptor activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007266 all species →	Biological Process	Rho protein signal transduction	Interproscan
GO:0009986 all species →	Cellular Component	cell surface	Interproscan
GO:0015026 all species →	Molecular Function	coreceptor activity	Interproscan
GO:0048406 all species →	Molecular Function	nerve growth factor binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K02583	NGFR, TNFRSF16, CD271; tumor necrosis factor receptor superfamily member 16	-	CD molecules	ko04090	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora microphthalma tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora microphthalma, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →