Gene detail

Detailed information of amic_s0012.g50.t1 in Acropora microphthalma

Genomic Location: sc0000012_pilon:786674...802550
NR annotation: XP_029195176.2, ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1-like [Acropora millepora]
Species Acropora microphthalma · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amic_s0012.g50.t1

ACAGCGGTGAAACGCCAAAAAGCACGTTTCCAACATGGCGGCAGTATCAACTTGATCTGTGATGAAAATTCCACTTTTGACTGATAATTCCTACGTCTAGTGTCTCAACTATGTCGTTTGTTCCAGCTGGGGCTGAGGATTCGGATTCAGAAGATGATGGGTTTTATATGGGAAGTTCTTACACCGGGAACTCAAATCATAATAAGTTTGGTATGAGGAATGGTGGCGACATGAGCAGATCCGTATCCTCCTCCAAAGGTTTCACCACGATGCCTGCTGGCGCTGAGTCTGACGATGAGGACAGTGATGGCTTTGAAGTTAACAGCACACCATTTCATTCTGTTTCTTCAACTGCATCTCAAACTTATGAGAAAAAACCGAACATGAACTTAAATAAATCAAATGATGTTGTTAGTTTTTCACATACTACATCTGCTGTGGCTGTCGGCAAAGGACAGAATATAAAGCAGAGAGGACGAGGGAGAGGGGGGTTTCCAAGACCCCCGGCATCATTCAGCAATCGAGGAAAACCTGCCAGAAGGGGTAATTTCATTCCAAGCAATGGATCCAACAAACAGGCAGATACCAGGAAAGCAGCATTATCACTTGCTGTGGATGATTTGCGAGTTGCAATTCAAAAAGGAAATATTGCTGCAGTTCAGAAATATTTAGATGATGGTATTGATCCTGATGTTCATCTTAAGTCAGGCTGGACGTCTTTGATGCTTGCAGCAAGCACAGCATCTTCAGATCTTGTGGAGTTACTAATAAGCAGAGGAGCAAATGCCAATTTTCAGAAAGAAATGTACACAGTACTTATGGCAACTTGTGCAGCTTCAAGGTCAGTTGCAGAAGAGCAAGTTCTCAGATGTGTGGAGCTTTTGCTGGGGAAGAATGCTCGGGTCAATGTTTATGACAAGTATCGCATGTCCCCGTTGATGTATGCAGCAAGGGAGGGGCGGGTGACTGTCTGTGAGAAGTTGCTTGAGCACGGTGCAGAGGTCAACAAACAGGAAATGCGAGGCTGGACGTCATTGGCATTTGCAGCTGGTCGGGGTCATGGAAGAGTTGTTCGCACTCTGCTGGATCGTGGAGCAGACGCTAACATTTGCACCAATGATGGACAAACACCAAGTGACATTGCATATGCCAGTGATTACCCGAGGCTTTCAGACGTCATTGCACTGGCTGCAAGTGGTAAGCAGACACCTAGTACAGAAGTTGCTTTGGATGCTGCAAAACCAACCATCAGCAGTCCTATTGACAACAGTCCTCACACATATGGCAGCCTTGAAATGTTTCTCATGGGTCAGGGTTTGAAACATTTGTTGCCAAAATTTCAGGAACACAAAGTAACTTTTGATGGACTTTTGGGTTTGACAGAAAAGGAACTTGACCAGATGGGGATTACACAGGTGGGTGTTCGAACCAAGATCTTGGATGGCATTCGAGAAGTCCACAAGAAAGAGTGGGACGCTTCTAGCTTACAGACAACGGAGAAGCACTCATTGAGTGCCGAAGAGGTCACAGTTATTCTGGCAAATGTGTCTCGACATTTGACTTTTTTAAGGAGCAGTGTCTCTTTCGTGCAGAAACACTTAAACACCGTCAGGGAGCCCTTGGATTTCGTACAGGATGTTACGGCGGCCGAAGGGATGTCGTTATACTGCAGAGAAGCAAATGAAGCTTCTCAGGAATTGAACGAAGAACTTGACTCCGTCTCGAAGCGAATTTCTCAGATCAACTCTAAAGTATCGAAAACTGCGCCCGATCTGATCGTCGACCAAAAGCCACAGCCAGCCCAACACTCGTCAAAGGGAAGTCTGGGGCTAGTCTTGACGGGTACCGCAACCCTTGCCATCAACTCTAAAGTATCGAAAACTGCGCCTGATCTGATCGTCGATCAAAAGCCACAGCCAGCCCAACACTCGTCAAAGGGAAGTCTGGGGCTAGTCTTGACGGGTACCGCAACCCTTGCCGTAGGTGCATTCTTGGTTCATCGATTCTGGCCCAGCACGTGATCTAACTCGTGATTTATTGAAGAAACAGACTGCAAGGGGACCCGAGGTCAAAGGTCACTGTGATTATCCGCGCAGTTTACAAAGGTCCGCCATGGCCGCAAACACCGTTCTGCAATTGTGAACTGCTCTCAACGTTTCATGACAAAATTTGGCCGTTGTCGCCGCTCATTACTTGAACGAATTGTAAAGATTTAAAAGTAAATATCATTGTAAAGATTAAAAACCCTGTGTATCTTGATTTTATTCCACAAATGTAGAAGAATTCGTTGCATTACTTAATGATAATAAAACGCTGTTTGATTTTTGAAGCAAGATCATTTGTTATGTTTTTGCATTCTTATCACTTCGCTTTTGGATCAGAAGAGCACAAAAGAGTCGGAATTTTGCTTGACAGCTCCAAATTGCAGATATCTCGCCACGGGAGACAGAATAAGATTTCTTTTCAAGATCAAATTAAATAGAATGGACGGGCGAGG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q09YK6	Ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1 OS=Ateles geoffroyi OX=9509 GN=ASZ1 PE=3 SV=1
Q2QLB5	Ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1 OS=Plecturocebus moloch OX=9523 GN=ASZ1 PE=3 SV=1
Q8WWH4	Ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1 OS=Homo sapiens OX=9606 GN=ASZ1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005156 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF13857 all species →	Ank_5	Ankyrin repeats (many copies)	Repeat	Interproscan
PF00536 all species →	SAM_1	SAM domain (Sterile alpha motif)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042650 all species →	Domain	ASZ1, SAM domain	Interproscan
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR001660 all species →	Domain	Sterile alpha motif domain	Interproscan
IPR013761 all species →	Homologous_superfamily	Sterile alpha motif/pointed domain superfamily	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24157 all species →	ANKYRIN REPEAT, SAM AND BASIC LEUCINE ZIPPER DOMAIN-CONTAINING PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0034587 all species →	Biological Process	piRNA processing	Interproscan
GO:0071546 all species →	Cellular Component	pi-body	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K18410	ASZ1, GASZ; ankyrin repeat, SAM and basic leucine zipper domain-containing protein 1	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora microphthalma tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora microphthalma, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →