Gene detail

Detailed information of amic_s0039.g2.t1 in Acropora microphthalma

Genomic Location: sc0000039_pilon:92462...106765
NR annotation: XP_029208413.1, cytosolic isocitrate dehydrogenase [NADP]-like isoform X2 [Acropora millepora]
Species Acropora microphthalma · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amic_s0039.g2.t1

AATAGGAGGTAGACGGACGAAAATAAACAAGGGGGTGGCAGGGGTCAGCAGGAGTCAGTGTTTTGACTGTTTTGCGCGTGACGGCTCGTCGTTTCTCACACAAGTTGAGTCCAAACAATCACCTGTGGATAAGACGTTGAATCATGTGTCTCCAATGCTTGTCAAAGTGTGTAAAATTCCGGAATAAATAAGTAAACAGGGAGCGGCAAGGAAAACAAATTGATTTGATTGCTTTCCGTGACTTACCCATTTTGTCTGGAACAACAGACCTGTTGAAAGGCTAAACAGATTCATCCAATCAGAGGATAGGATAACAGCACAAAATATGCATTCCGGCTTATATTTCCTGCATACTGAAAATGGCGGCAATTGCAGGTTGCTCTCGCATTCGTCCTTTAGGAATACGAAATGCTTTGCATCGCCTGTTTTCCTGCACCTCTATTGAACTTCAGAGGCAGCAAAGGAACTTTTGTCATCATGGACATGCGACAAAAATTAAAGTTGAGGGCCCAGTTGTGGAAATGGACGGAGATGAAATGACGCGTGTCATTTGGAAAATGATTAAAGACAGGTTGATCTTACCCTTCTTGGATCTGGACATCAAATATTTTGATCTTGGGCTGCCATATCGTGATGCAACAGATGATAAAGTGACCACAGAAGCAGCAGAAGCCATAAAACAGTACAGTGTAGGAATTAAATGTGCAACAATCACTCCAGATGAAGAAAGAGTGAAAGAATTCAATTTAAAAAAGATGTGGCGTAGTCCCAATGGTACAATTCGTAACATTTTGGGTGGCACAGTTTTCCGTGAGCCAATCATCTGCCAGAAGGTTCCAAGACTTGTTCCAGGCTGGGTGGAGCCCATTGTCATTGGAAGACATGCTCATGGTGATCAATATCGTGCTAGAGACTTTGTGGTGAATGGGCCTGGAGTGTTTGAAATCTCCTTTTCCCCAGCTGATGGCAGTGGCAAACTTACCACTGAGGTGTTTGAGTTCACTGGTACTGGAGGTGTGACTATGGGAATGTATAACACTGACGAGTCAATCAGGGAATTTGCTCATAGCTGCTTCCAATATGCCTTGAATAAAGAGTGGCCTCTTTATATGAGCACCAAAAACACCATTCTGAAGAAGTATGATGGCAGATTCAAAGACATCTTTGAAGACATCTATCAGAGGATTTATGAAAAACAATTCAAAGACTTAGGGATTTGGTATGAACACAGACTTATTGATGATATGGTTGCCTATGCTATGAAGGCACCAGGTGGATTTGTTTGGGCTGCAAAGAATTATGATGGAGATGTCCAATCTGATACACTTGCTCAAGGTTTTGGTTCCCTTGGTCTTATGACAAGCGTGCTTGTCTCTGGAGACGGGAAAACAATTGAGTCCGAGGCTGCACATGGTACCGTGACTAGGCACTACAGGCAATATCAAAAGGGTAACGAAACAAGCACAAACCCGATTGCCAGTATTTTTGCTTGGACTCAAGGGCTGCGTCACCGCTCAAGACTTGACAAGAACGTTGAACTCAAAAGATTTTGCAAGGCTCTAGAAAAGGCGTGTGTGGAAAGTGTTGATTCGGGGTACATGACAAAAGATCTTGCTGGTTGTATCTATGGACTTAGCAATGTAAAACGTGACCAGTATTGTTCAACTGAAGAGTACTTTGATGCTGTGGAGAAGAAATTAATTGAGCTGTTTCAGCCGGCTTCCTGATTGGAGCAAGTTGAGTTACTGTGTGTTATCGTCTGAAGTGCTGCAGCACGTAGCTTGACGTCGTTATTTTCAACAAGACGTTTTAAGCAATTTCGTCTTATCTTATGCAAAGGCTGAAAGGACACACTTCATGCCGGGACAAATCTGTTGGCCCTTTCAAATCTCTTCCTGCTTTGTTACCTTACCAAAGAAAAGTTGATTTCGAGCCACGTTTTATGAATACTAATAGACATTGTAACGAAAATTAGCAATGGGGAAGAATTAAACAATGAGCCTGCAGTATTTGCGACAGTAAGTAAGGAAAGTTCTTCAGTCAGAGAGGAGATAGGCCCGGGTTCCCTTTCAGCTAAGTGCATATAGTGTGATCGACGTAGAGATGCATGACACCTGGTAGTCATTAAACATGCTTTGAATGTGGTAGTAATCATGTAGTTAGAATTCTGTTTTTTTTATGGTAACCGCACAGTTTTTAATGGTAAACATGATGGAAAAACACCAGAGTGCACACACGATTGCAATGATAACAGGTTCCGTAGAACTTTACACGAAGCAATAAAAGTTTTCATTTTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q04467	Isocitrate dehydrogenase [NADP], mitochondrial OS=Bos taurus OX=9913 GN=IDH2 PE=1 SV=2
P33198	Isocitrate dehydrogenase [NADP], mitochondrial (Fragment) OS=Sus scrofa OX=9823 GN=IDH2 PE=1 SV=1
Q4R502	Isocitrate dehydrogenase [NADP], mitochondrial OS=Macaca fascicularis OX=9541 GN=IDH2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001890 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00180 all species →	Iso_dh	Isocitrate/isopropylmalate dehydrogenase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019818 all species →	Conserved_site	Isocitrate/isopropylmalate dehydrogenase, conserved site	Interproscan
IPR024084 all species →	Domain	Isopropylmalate dehydrogenase-like domain	Interproscan
IPR004790 all species →	Family	Isocitrate dehydrogenase NADP-dependent	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11822 all species →	NADP-SPECIFIC ISOCITRATE DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0016616 all species →	Molecular Function	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor	Interproscan
GO:0051287 all species →	Molecular Function	NAD binding	Interproscan
GO:0004450 all species →	Molecular Function	isocitrate dehydrogenase (NADP+) activity	Interproscan
GO:0006102 all species →	Biological Process	isocitrate metabolic process	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005777 all species →	Cellular Component	peroxisome	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006739 all species →	Biological Process	NADP metabolic process	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K00031	IDH1, IDH2, icd; isocitrate dehydrogenase	EC:1.1.1.42	Central carbon metabolism in cancer	ko05230	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora microphthalma tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora microphthalma, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →