Gene detail

Detailed information of amic_s0127.g16.t1 in Acropora microphthalma

Genomic Location: sc0000127_pilon:140106...152760
NR annotation: XP_029179814.2, mRNA-capping enzyme-like isoform X1 [Acropora millepora]
Species Acropora microphthalma · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amic_s0127.g16.t1

GGTCGATGATCAAGGAAATAAAAATGCGACCTGTCTTCCGAATACTCGTCTAGAGCAGAAGTAGATCTCACCTGAACTTTGAGATAATGTCTGTTCCACCAAGATGGATGAACTGCCCCAGGAAAAGCAAAATAATTGCAGAAAAATTCCTTGCATTTAAAACACCTTTGGGGCTTCGTTATGATGCTGAAATCCCAGAAGCAAATCGCTTTCAACTGCCCATGTTGTTTGCTTATCTACAGTCACTGAAAGTGAAATTAGGATTAATCATTGATTTGACAAACACAAATCGTTTTTATGACAAAGCAGAAGTGGAAAATAGTGGAATTGGACATGTTAAGTTGCGTTGCCAAGGGCGTGCTGAAACTCCCACGAAAGAACAAGTCAATACTTTCATCGGCATTTGTGATAAGTATTTCAACCAAAACCCTGGCCAACTCATAGGTGTTCACTGTACCCATGGTTTCAACAGAAGTGGATTTCTGATTATTGCATATCTTATTGAACGGGATGACTGGAGTGTAGAGGCAGCAGTGCGATGCTTTGCACAGTGTCGTTCACCAGGAATCTATAAACCTCATTACCTACATGAACTTGTCAGTCGTTATGGAGATCTAAGGGAAGCTATTGCACCACCAGAGTTACCTGATTGGTGTCTTGATGAGGAAGACGATTTAAGCGACAGCGAATACCAAAATGGTCAAACAGCCGAGGATGGGAGTCGACCTGACGGAAGCAGGAAGCGATTCAAAAGAGATCCCAGACTCAAGGAGGCCAAGTTCTTTGATGACATAGATGGTGTAGAGGTTGTGCAGTCCCCCAAAAGAGAAGAAATCCAACAAGTCTGCCAGAAAATGTGTTCTTGGGACAGTGGTGGCTTCCCTGGTAGTCAGCCAGTATCAATGGATGTACGAAATATAAAGCTCTTGCATGAAAAACCTTACAGAGTGAGTTGGAAAGCTGATGGTGTCAGATATATGATGCTTATTTTGGGAGAAAGAGAAGTCTACCTGATTGATCGAGACAACAATGTCTTTGCTGCACCACAGTTGCACTTTCCTCAACGTAAATTCCCAAAAGAGCACGTCTATGATACTTTGCTTGAGGGGGAAATGGTTCTTGACAAGGAAAACGAAAGAAGCTACCCGAGGTACCTGGTTTACGATATCGTTAGATTTCAAGGTCAAGAAGTTGGTAGACAAAGTCACGAGATAAGGATGTTGTGCATTGAAAAAGAAATAGAGATGGCTCGCAGCTTAGCTGCTCAACAAGGATTATTTGACAAATCAACAGAACCGTTTAGTATACGGGCGAAAAAGTTCTTCTCACTGGAGAAAACGGAATGGGTTCTCGATCACTGGAGCCCTAAACTAAGTCACGAAAATGATGGCCTCATTTTCAATCCTGCCGAAGAGCCTTATGCCGGCGGACAGAGCCCTGAAGTATTGAAATGGAAGCCACATACACTCAACTCCGTTGATTTTATCTTAGATATTAGGACTGTTAAACAAGAGGGCTGTATCCCTGAAACACATGGCAACCTAATGGTCGGTGGATATGACAAACCATTTGCTCCGATCAAGGTAACGAAGGAATTAAAAAATCTGAACAAGAAGGTCGTGGAATGTACGTGGGATAGCGAAACCAAACAATGGAAGTTTCTCAGGGTTAGAGAAGACAAGAGTTTTCCTAACGGCTACAACACCGCCATAAGTGTTTGTCAGAGCATACAGCAGCCTGTTACAAGGCAATGGCTCCTGGAAGTTATTGAAAAACATCGCTTTAAGCAAAACCGCCACAGGACCGCTTCGAAGAGTCAGTCGATGTAAATATCACTGGATTCGGCGAGCGTTATTTAGAAATTCTTCATAGAAGAGCCTGAGAAGAGCGATTTCAGGCGACTCTGAATGCTACTTCCGCTCAGGCAGTGATTTTGAACTCAGCTGGAACACCTCCGAGCAGCAAAAGTTTAGCAATAGTTACCAAAACCTCGAAAAAGCCTTAAAAGGAAGTTTCTTACGCATGCTCTGGGTGATTTTGGCGATGTTCAGTTGGGAATTTTTTGCAGATATTTTAATAGGAGTAAAGAGTCGCATCGAGTAGAACACATCAACCACGAATGCTCAAGTAAACCCTTGATTTATAATATTAATGCACTCGTATGTTGCATTTGTCGAAAAACTCTCTGAGCGCCACCTTGTTAGAAGAATTGGTGCGCATAAAGATACAAAATTAATTTGTCGCGAACGACTTGATTTTGCTGTAAATATGTATATTGCTTTAATTTATAGTCAATTCATAGTATATAGTTTTTCCGATGCCGCTCATCTAAAGTTTGACTAGCGTGAACATGTTATGGTTGCCCAGACTCTTCCTAGAAAACCAACCTTGGCCAAAGCATGACAGCTTGTTAATTTTCTCATAAATCAATAACTTCGTAAATACTGAAGGAGTCCTTAGTAGGTTTGCCAAACTTGTATCATGTTGATAACATGACAACTTTTTACTGAGCACTTTTCAGGATGTTTTCTATTCATTCTATTCATGTATAGCGTGAGCAGAAAGTTGCATCT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NY98	mRNA-capping enzyme OS=Danio rerio OX=7955 GN=rngtt PE=2 SV=1
O60942	mRNA-capping enzyme OS=Homo sapiens OX=9606 GN=RNGTT PE=1 SV=1
O55236	mRNA-capping enzyme OS=Mus musculus OX=10090 GN=Rngtt PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004948 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01331 all species →	mRNA_cap_enzyme	mRNA capping enzyme, catalytic domain	Domain	Interproscan
PF03919 all species →	mRNA_cap_C	mRNA capping enzyme, C-terminal domain	Domain	Interproscan
PF00782 all species →	DSPc	Dual specificity phosphatase, catalytic domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000387 all species →	Domain	Tyrosine-specific protein phosphatases domain	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR016130 all species →	Active_site	Protein-tyrosine phosphatase, active site	Interproscan
IPR029021 all species →	Homologous_superfamily	Protein-tyrosine phosphatase-like	Interproscan
IPR020422 all species →	Domain	Dual specificity protein phosphatase domain	Interproscan
IPR051029 all species →	Family	mRNA Capping Enzyme and RNA Phosphatase	Interproscan
IPR017074 all species →	Family	mRNA capping enzyme, bifunctional	Interproscan
IPR001339 all species →	Domain	mRNA capping enzyme, adenylation domain	Interproscan
IPR013846 all species →	Domain	mRNA capping enzyme, C-terminal	Interproscan
IPR000340 all species →	Domain	Dual specificity phosphatase, catalytic domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10367 all species →	MRNA-CAPPING ENZYME	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016311 all species →	Biological Process	dephosphorylation	Interproscan
GO:0006470 all species →	Biological Process	protein dephosphorylation	Interproscan
GO:0004484 all species →	Molecular Function	mRNA guanylyltransferase activity	Interproscan
GO:0006370 all species →	Biological Process	7-methylguanosine mRNA capping	Interproscan
GO:0140818 all species →	Molecular Function	mRNA 5'-triphosphate monophosphatase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13917	RNGTT; mRNA-capping enzyme	EC:2.7.7.50 EC:3.6.1.74	Messenger RNA biogenesis	ko03019	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora microphthalma tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora microphthalma, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →