Gene detail

Detailed information of amic_s0154.g33.t1 in Acropora microphthalma

Genomic Location: sc0000154_pilon:465820...484774
NR annotation: XP_029191353.2, histidine--tRNA ligase, cytoplasmic-like isoform X2 [Acropora millepora]
Species Acropora microphthalma · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amic_s0154.g33.t1

GTGTACGTTGGACAAGAAATTGTAGGTGGATTTTTCATATAGTGTACTTGAACGCGGAATTATAATCAATTATTTACCGCTGACCAAAACTAAATATGGCATCCAAAGGTCCATCGCCGTTGAGGAGTGAAATTCAACAAGAGATTAAAATACAAGGAGAGATAATCAGACAATTAAAGCTCGAAGAACAGACAGATGAAGTTAAAGATAAGACATTATGATGTCCTCCAAATTGATAAGGAATATTTTAACTGTTCCTAAATTGTTGCGGGTTGCTCAACTGTCGTGTTCACACTGGCTAGAAACAGAGTTGAAAGAAGAAATAGCAAAATTAATTGAGCTTAAAAAGCAACTTGGAGATGACCAAGGGAATCAAAAGTTTGTTCTCAAAACCCCAAAGGGCACTCGGGACTATGAGCCAAAGCAGATGGCCGTCAGGGAGAGAGCCTTCAAAGCCATTATCAAATGCTTTGAAAAACATGGTGCAGTACAGATTGATACTCCTGTTTTTGAAATGAAGGAAACACTGACAGGAAAATATGGTGAAGATTCCAAACTCATCTACGATCTTGCTGATCAAGGAGGAGAATTGTTAGCTCTTAGATATGACTTGACAGTCCCCTTTGCAAGATATGTTGCAATGAACAAGATTGACAAAATAAAAAGATATCATATTGCTAAGGTTTATAGACGTGACAACCCAGCTATGACAAGAGGGAGGTACAGAGAATTTTACCAATGTGATGTTGACATTGCTGGGCAATATGATGCTATGATTCCTGATGCCGAGTGTGTAAAAATTGTATCAGAAATACTAACAGAATTAAAACTTGGAGAATTTACAATAAAGGTCAATCACAGACAGCTGTTAGATGGAATGTTTGCTTGTTGTGGAGTACCAGAGGAGAAATTTAGATCTATTTGCTCTGCAGTAGATAAACTTGACAAACTTCCTTGGGAAGATGTAAAAGCTGAAATGGTTGGAGAGAAGGGCCTTGAACCAAGTATAGCAGACAAGATAGGAGAATATGTTAAGCATAAAGGTGGAATGGATCTGGTCAAGAAACTCACAGCGGACGAAGCTTTGATCAACAATAAAAGTGCCAAAGCAGCATTGGAGGACATGAAATTACTTCTTCACTATGTCGAACTGTTCGGTATTAAGGAGAAGGTATCATTTGATCTGAGTCTGGCTCGAGGCTTGGACTATTACACAGGAGTGATCTACGAAGCAGTATTAGCTGGGGAACAACCTGATCTTGGAAAATCTGAAAAAGGGGAGCCTGTGGGAGTTGGGTCAGTGGCAGGTGGTGGTCGTTATGACAACCTTGTCGGAATGTTTGCCAAAGGAAGAAAGGTTCCTTGTGTTGGCGTAAGCATTGGAATCGAAAGAATATTCTCCATTCTTGAGGCGCAAGCTCAGTTAAATGGACAAAAAATACGAACCTCAAAGACGCAAGTCTTGGTTGCATCGGGTCAGAAAAATCTCTTAGAGGAAAGAATGAAACTGGCTTCTGAGCTTTGGGACGCCGGTTTAAAGGCTGAGTTGCTTTACAAGAAGAACCCAAAGATGCTGAATCAGTTTCAATTTTGTGAAGAAAACGGGATTCCGTTTTGCTTGGTGATAGGCGAGAGCGAACTCCAACAAGGCGTTGTGACGCTGCGAGATATGGCGTCGAGAGAAGAGTTGGTTTTGACCGTCAAACTCAGTCGCGAAAATGTAAGCAGATGACCAAGTTTGTTTTCTTCGTAGCTTAAGTGATCGAAAACAGTCAATTCTTAATGGCAGTTTCAATATTATCATTACTAATGTTGCAATGAATATTCAATTTTGTCGTACAAAAAAATTAGCTAGAACATCTGTCTCAATTCAAAAGCCACGCTTTGTTTTGTTTCTTGAGTATACGTTGAGTTTCAAGGACTGAGAGAAAGAAAGGGCGGTAGAAAGGCGTCGGGTGTTTATCGATGGGAAACGGGAGTAAAGACAAAGATGGAGAATCCTCGCAGCCACTCGTGGGCAGTTCTAAGGGCGATGTGGAAGCTGGCGAAGATGGAATCACGAGCGACAAGTGTCAAAAGAAGAAGACTTGCGGGTCGAAATGTCTAGCTTGCTTTCGTTGTGTGTTTGGTTTCGTTATGTTCCCGTTCGTTTTCCTTATCACGTTGTTAACGGCGTTTCTGTGGATAATTCTTCTGCCAGCCAAATGTTGCTCGCCTTGCTGTATTCCATTGTTTAACTGGCTGCTTGAAGTACTTTTGTTGCCGGTGCGATTCTATCGTTGGGTTGTAGGAAAAGATCAAGATGAAAGAAAATAAAAATCTGTGACGTTA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q61035	Histidine--tRNA ligase, cytoplasmic OS=Mus musculus OX=10090 GN=Hars1 PE=1 SV=2
Q2KI84	Histidine--tRNA ligase, cytoplasmic OS=Bos taurus OX=9913 GN=HARS1 PE=2 SV=1
P12081	Histidine--tRNA ligase, cytoplasmic OS=Homo sapiens OX=9606 GN=HARS1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002417 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03129 all species →	HGTP_anticodon	Anticodon binding domain	Domain	Interproscan
PF13393 all species →	tRNA-synt_His	Histidyl-tRNA synthetase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR033656 all species →	Domain	Histidyl-anticodon-binding	Interproscan
IPR045864 all species →	Homologous_superfamily	Class II Aminoacyl-tRNA synthetase/Biotinyl protein ligase (BPL) and lipoyl protein ligase (LPL)	Interproscan
IPR004516 all species →	Family	Histidine-tRNA ligase/ATP phosphoribosyltransferase regulatory subunit	Interproscan
IPR004154 all species →	Domain	Anticodon-binding	Interproscan
IPR015807 all species →	Family	Histidine-tRNA ligase	Interproscan
IPR041715 all species →	Domain	Class II Histidinyl-tRNA synthetase (HisRS)-like catalytic core domain	Interproscan
IPR006195 all species →	Domain	Aminoacyl-tRNA synthetase, class II	Interproscan
IPR036621 all species →	Homologous_superfamily	Anticodon-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11476 all species →	HISTIDYL-TRNA SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0004821 all species →	Molecular Function	histidine-tRNA ligase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006427 all species →	Biological Process	histidyl-tRNA aminoacylation	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0032543 all species →	Biological Process	mitochondrial translation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01892	HARS, hisS; histidyl-tRNA synthetase	EC:6.1.1.21	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora microphthalma tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora microphthalma, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →