Gene detail

Detailed information of amic_s0158.g17.t1 in Acropora microphthalma

Genomic Location: sc0000158_pilon:203414...224485
NR annotation: XP_044174931.1, X-ray repair cross-complementing protein 6-like [Acropora millepora]
Species Acropora microphthalma · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amic_s0158.g17.t1

CTTGATCCATAAAGAAATAAATCAAAGATGACCCACCTTAATTTGTTGCCAACATCTTTCGACGACGTAAAGGAAACCAAGCACTTTCTGCGAAGAGTGAAGAATAAGGGGTTTAGTTCCCGTTGTTAAGGTAATTCTATTTCTGCCAGCGTGTGTTTCGCCCGACTGGATTGAATAGAAGAGCTAGCGACTGTAGTGGGAAAGGAGAGGCCTTATCTCAAACCTTCCACAAACGTACGACTGCACCTTTTATGGACACTACGAATCGCGTACATAAGCCAACATTAACAGTTGTGTGGAGAGAGGAATGGCACCAGCGCGGGAAGTACTCTGCTTTCCTGCAAACAAGCATCGAAACTGGATTTCTGGAAATAAGTAGATTTTTCTGATTCAGAGCATATGTTGACTTGAATTAGCTGGATTAAACTTAGATTTCATTCTAGTTTTTCTCGGATTTCTGAGACGACATATCTGTAAAACAAATCGTATCCTGATCGTATCAAGACATGTCAGACTGGTCGTCAACATTTTGGGCAAGCACTACGGGATTGTTTGGTGAAGAAGATGAAGTCGATACGTTTGATCCAGATCAACAGACACGATGGGACAATAAGGACAGCCTCATCGTGGTTATTGACTGCTCAAGAGAAATGTTTGAGAAGACAAGAGGAGAAATTCCATTTCAACTTTGCATCAAATGTACTGTTAGTGTGTTAAAGAACAAAATTATCAGCAGCGATAAAGACTTGATCGGTTTGGTTTTCTTTGGAACTGATAAAAGCAAAAACCCAAGTGATTTCAAGCAGGTTTATGTCTACCAGGAGTTAGATTTCCCAGATGCCAATCGTATACTTGATCTGGAAAAATTTCTTGAAGATGATAGTTGTGACAATTTTGCAACCAGATTTGGACACAACACTGGATATTCCTTGAACGATGTTCTTTGGACATGTTCTAATATGTTTTCGAAGAGCTCTCAAAAGGTTGGACATAAACGAATTATGCTGTTTACAAACAATGACAATCCACATGCAGACAACCCTTCCCTGCAAAGACAAGCGAAGACAAAATCCAGAGATCTCAGTGAGATTGGCATTGAAATAGACTTGATGCATATGCAACCTCCCAATCGTGCTTTTGATGCCAGTCTTTTTTATCAGGATGTAATTCAACTGGATGAAGATGAATGTGGGATTTTGCCTGATCCTGCTGAAATGTTTGAAGAACTACTTTGCAGGGTTCAAAGAAAGGAGTACAAGAAGAGGCCCTTGGCAACTCTCCCTCTGACCTTAGCTGGTGGAATTGAGTTGGGAGTTTCTGTATATAATCTCTGCAGATCTGCAACCAAATCCAGCTATGTTAACTTGGATAGCCACACAAATGAAGAAGTTAAGATACACACCAAATACATTTGCAAGGACACTGGCAGAGAACTAATGCCAACAGACATCAAACTTTATCAAATGTTTGGAGGTGAAAAAGTTATTTTTGAAAAGGAAGAAGTTACTTCCATGAAAACATTTGGCGACCCAGGACTCCTTCTGATGGGATTTAAACCAAGATCTTCAGTGAAGACTTATCATCACATCAGACCAGCACAGTTTCTTTATCCAAGTGAAAAGAGTGTATCAGGAAGTACTACATTATTTTCTGCACTACTTGGTAGATGTATTGCTAGGGATGTTGTACCCATATGCCGATTTATTCCACGCAGGAATTCTCCACCAAGATTTGTGGCTTTGCTCCCTCAGGAAGAAGAGCTAGATGAACACAACAACCAAGTCAGGCCACCAGGATTCCATGTGATATTTCTTCCTTTTACTGATGATCTCAGAAGACTCAAATACGAACAGACACCAAAAGCCACAACTGAACAGATCAACAAAGCGAAACAAGTTATCAAGAATTTAACATCTGGATTTGACAGCTCAAACTTTGAAAATCCCTCCTTACAAAAACATTTCAAGAACCTTGAAGCTCTGGCCTTAGACAGAGATGAGCCTGAAGAATTGATTGATCACACAGAACCAAAAACAGAAGCAATCGATCGCAAAGCTGGTGAAGCAATAAAGCAGTTTAAGGATGTAGTTTTTCCTGATGATTATGATCCACTAGGAAAACCTGCAGCCACTAAGAGAAAGGCTGGAACTGCAGATGGAAGTGCAGCCAAGAAGGGCAAAGCAGGCAGTGATGTTGAAATTGACATGAGGGAAGAAGCACACAAAGGAAGGCTTTCCAAGCTGACTGTTCCAGTGTTGAAAGACTTTGTTAAGCAAGCAGGAATCAAGTGTGGAACCAAAAAGGCTGATTTAGTTGAGGCTATAAAAAATCATTTTGGCGTTTCATGAGAAAAAAACAAAGATCAAAATAGTAGTAAGAAAGTCACACCAACAATCTTTTGGAAATAGTACTTTATGATGGAAAACAGCTCCTTTTTTTACCAATTTCATTAGGTTTGTAACATGTCGTATTGTTTCCAATGATCAGAAAGATTCTCTTGCTAGAAAAGAATGGCTCATGGAGGAAAGCTTGTATTTGGAGTCATTGTCAAGTTGCTAATTTTTGACTAGATAACATTTAGAGAGTCTACCACAATAAATATTGTTGTGCTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O93257	X-ray repair cross-complementing protein 5 OS=Gallus gallus OX=9031 GN=XRCC6 PE=2 SV=1
P12956	X-ray repair cross-complementing protein 6 OS=Homo sapiens OX=9606 GN=XRCC6 PE=1 SV=2
P23475	X-ray repair cross-complementing protein 6 OS=Mus musculus OX=10090 GN=Xrcc6 PE=1 SV=5

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005391 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03730 all species →	Ku_C	Ku70/Ku80 C-terminal arm	Family	Interproscan
PF03731 all species →	Ku_N	Ku70/Ku80 N-terminal alpha/beta domain	Domain	Interproscan
PF02735 all species →	Ku	Ku70/Ku80 beta-barrel domain	Domain	Interproscan
PF02037 all species →	SAP	SAP domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006165 all species →	Family	Ku70	Interproscan
IPR005160 all species →	Domain	Ku70/Ku80 C-terminal arm	Interproscan
IPR005161 all species →	Domain	Ku70/Ku80, N-terminal alpha/beta	Interproscan
IPR036361 all species →	Homologous_superfamily	SAP domain superfamily	Interproscan
IPR006164 all species →	Domain	Ku70/Ku80 beta-barrel domain	Interproscan
IPR016194 all species →	Homologous_superfamily	SPOC-like, C-terminal domain superfamily	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR047087 all species →	Domain	Ku70, core domain	Interproscan
IPR003034 all species →	Domain	SAP domain	Interproscan
IPR027388 all species →	Homologous_superfamily	Ku70, bridge and pillars domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12604 all species →	KU AUTOANTIGEN DNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000723 all species →	Biological Process	telomere maintenance	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0003684 all species →	Molecular Function	damaged DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006303 all species →	Biological Process	double-strand break repair via nonhomologous end joining	Interproscan
GO:0042162 all species →	Molecular Function	telomeric DNA binding	Interproscan
GO:0043564 all species →	Cellular Component	Ku70:Ku80 complex	Interproscan
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan
GO:0003690 all species →	Molecular Function	double-stranded DNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10884	XRCC6, KU70, G22P1; ATP-dependent DNA helicase 2 subunit 1	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora microphthalma tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora microphthalma, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →