Gene detail

Detailed information of amur_s0208.g5.t1 in Acropora muricata

Genomic Location: sc0000208_pilon:57586...76207
NR annotation: XP_029182890.2, alpha-aminoadipic semialdehyde dehydrogenase-like isoform X1 [Acropora millepora]
Species Acropora muricata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amur_s0208.g5.t1

ATGTCACATATCTGAAAAGGAAAAAAAGATTATAAAACAGAGGTTTTAACTCTGTTAGGCTACCCCTCAGTTGTTAGATGAAAACGTTCATTTCACAATACAATATTAATTTGTGATAGAGAAGTCCTGGTAACGAAACTGCCTTTTTCCTTCGCTCAAGCATAATGGCGGTACGTGTTCTTTCGTTTGCTCCCAAGAACTTAGCATTCCGTTCTATTTTCTTGGGTTTAAGTCGGGCTTCTTTCTGCTCTGCACAGGAAGAAACTTTATTGATAGATGAAGCGAAATATTCCTGGCTCAAAGATCTTGGTCTGAAAGCGGAAAATGACGGAGTATTTAATGGCTCTTGGGGCGGCAAAGGACAGACTGTAACCTCCGTATCCCCTTCAAATGGACGACCAATTGCAAGAGTACGTCAAGGTTCTTTGGAAGATTACAGTGAGACAGTAAAATGTGCAAAGGAGGCCTGGAAATATTGGGCCATGACACCTGCTCCTAAACGGGGAGAAATAGTTCGCCAAATTGGTCAAGCATTGAGAGACAACTTGGAAAACCTTGGAAAATTGATTGCACTTGAAGTGGGTAAGATCAAACCAGAGGGTGTTGGTGAGGTACAAGAGTTTATTGACATTTGTGATTATGCTGTTGGCCTTTCACGAATGATGGATGGAAAAGTGCTACCCTCAGAAAGGCCTGGTCACGCACTTCTTGAACAGTGGAACCCAGTTGGTCTGGTTGGTGTCATCACTGCATTCAATTTTCCCTGTGCAGTTTTTGGATGGAACAGTAGCATTAGTATGGTGTGTGGAAATGTGAATCTGTGGAAAGGTGCTCCATCAACTCCTCTTGTAAGTGTTGCAATCACAAAGATTATGACTGAAGTGTTAGCTCGCAATTTAGTCCCAGGAGCTGTATGTTCACTGGTTTGTGGAGGTGCAGATATTGGTCAAGCTATGGCAGAGGATGAAAGAGTTGACCTGTTGTCCTTCACTGGTAGCACAGCGGTTGGAAGAAAAGTTGGCACAACAGTACAAAGTAGATTTGGAAGAAAAATTTTGGAACTTGGTGGCAATAATGCTATTATTGTGATGGATGATGCTGATTTAGATCTTGCCATTCCATCAGTGCTGTTTGCTTCAGTAGGCACTGCAGGTCAGAGGTGTACCACAACAAGAAGGCTGACAATTCATGAGACAATTCATGATGAAGTGGTGGATCGCTTAACAAAGGCTTATGCTCAAGTGAGAATAGGAGACCCACTGCATGAGGATACGCTTTATGGTCCTGTTCATTCTGAAATGGCCATTAATATTTACAAGCAAGCACTGGAAGATGTCAAAAAGCAGGGTGGAACTATTGCTTTTGGTGGAAAGGTCTTAGAGGGACCTGGCTACTACGTTGAACCAACCATTGTCACTGATCTTGCTCATGATGCAGAAATAGTGCACAGGGAATCTTTTGTCCCTATCCTTTATGTGCTCAAGTGCAAGACCACTTGGGTCTGACTGTGGACTTGTCAATGTCAATATTCCAACAAGTGGAGCAGAAATTGGAGGTGCTTTTGGTGGTGAGAAACACACCGGTGGCGGCCGAGAATCTGGCAGCGATGCATGGAAAGCTTACATGAGGAGATCAACTTGTACTATTAACTTTGGCAAAGACCTTCCCCTTGCCCAAGGTATCAAGTTTGGGTGAAGAATGAATGATGTGGAAACTATGGCAACTCTTGTTTAATGGCCTAATACAGTGATAGCAATAAGTAAAGAAAGGGTGGCTTCATCTATTATACAGTTAGCATTTTACCCCCAGATTGAACTGTATTTAGTGCAGTATTTACAATATGTAGAATTGTTTGCTGTGTGTCTTGATGATGTTACTAGGAAGTACCCCATCATATAATTGTATTTAAGGCTTTGTGGAACTATAAAGTAATTAACCATTAAAAACATCAAATGCACACATTAATGTAACCCAGGAGGGATCAAGCATTCCATACACAAAATGGTTAAGGATGAGTGTGCTATCAAAGGAAGAGTTTATACCCCAAGGATATGTTTGGTTTGCAAAAACATGAATCTGCAGTGGCTTCAAATGTAGTTTTGATTGCAAATGCTATAAAAGTAAAGTCCTGAGAAAATC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P49419	Alpha-aminoadipic semialdehyde dehydrogenase OS=Homo sapiens OX=9606 GN=ALDH7A1 PE=1 SV=5
Q2KJC9	Alpha-aminoadipic semialdehyde dehydrogenase OS=Bos taurus OX=9913 GN=ALDH7A1 PE=2 SV=4
Q64057	Alpha-aminoadipic semialdehyde dehydrogenase OS=Rattus norvegicus OX=10116 GN=Aldh7a1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003228 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00171 all species →	Aldedh	Aldehyde dehydrogenase family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR044638 all species →	Family	Aldehyde dehydrogenase family 7 member A1-like	Interproscan
IPR016161 all species →	Homologous_superfamily	Aldehyde/histidinol dehydrogenase	Interproscan
IPR016162 all species →	Homologous_superfamily	Aldehyde dehydrogenase, N-terminal	Interproscan
IPR015590 all species →	Domain	Aldehyde dehydrogenase domain	Interproscan
IPR029510 all species →	Conserved_site	Aldehyde dehydrogenase, glutamic acid active site	Interproscan
IPR016163 all species →	Homologous_superfamily	Aldehyde dehydrogenase, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43521 all species →	ALPHA-AMINOADIPIC SEMIALDEHYDE DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004029 all species →	Molecular Function	aldehyde dehydrogenase (NAD+) activity	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan
GO:0016620 all species →	Molecular Function	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14085	ALDH7A1; aldehyde dehydrogenase family 7 member A1	EC:1.2.1.31 EC:1.2.1.8 EC:1.2.1.3	Alcoholic liver disease	ko04936	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of amur_s0208.g5.t1 across 82 RNA-seq samples of Acropora muricata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

82Samples

70TPM > 0

2Conditions

217.4Max TPM

81.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Polyps	79	70	84.64	217.39
Severed branch	3	0	0.00	0.00

Per sample · hover a bar for the full sample record

Show the sample table (82 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR27868180	Polyps	Polyps	regeneration day36	not recorded	SRP199550	217.39
SRR27940226	Polyps	Polyps	not recorded	not recorded	SRP199550	164.52
SRR12786901	Polyps	Polyps	OA 2 day0	not recorded	SRP199550	146.73
SRR27868194	Polyps	Polyps	regeneration day21	not recorded	SRP199550	142.71
SRR12786899	Polyps	Polyps	OA 2 day0	not recorded	SRP199550	141.94
SRR27868202	Polyps	Polyps	regeneration day15	not recorded	SRP199550	141.91
SRR12786900	Polyps	Polyps	OA 2 day0	not recorded	SRP199550	140.31
SRR27868205	Polyps	Polyps	regeneration day12	not recorded	SRP199550	140.20
SRR27868201	Polyps	Polyps	regeneration day15	not recorded	SRP199550	140.20
SRR27868203	Polyps	Polyps	regeneration day15	not recorded	SRP199550	139.65
SRR12959206	Polyps	Polyps	E2 day0	not recorded	SRP199550	126.14
SRR27868187	Polyps	Polyps	regeneration day3	not recorded	SRP199550	125.67
SRR27868198	Polyps	Polyps	regeneration day0	not recorded	SRP199550	114.92
SRR12959195	Polyps	Polyps	E2 day0	not recorded	SRP199550	112.02
SRR27868204	Polyps	Polyps	regeneration day12	not recorded	SRP199550	111.40
SRR27868177	Polyps	Polyps	regeneration day39	not recorded	SRP199550	111.20
SRR27868176	Polyps	Polyps	regeneration day3	not recorded	SRP199550	108.69
SRR12904784	Polyps	Polyps	not recorded	not recorded	SRP199550	107.95
SRR27940224	Polyps	Polyps	not recorded	not recorded	SRP199550	107.34
SRR27868209	Polyps	Polyps	regeneration day0	not recorded	SRP199550	106.61
SRR27868158	Polyps	Polyps	regeneration day6	not recorded	SRP199550	106.60
SRR12959217	Polyps	Polyps	E2 day0	not recorded	SRP199550	104.13
SRR12904785	Polyps	Polyps	not recorded	not recorded	SRP199550	103.90
SRR27868206	Polyps	Polyps	regeneration day12	not recorded	SRP199550	103.46
SRR27868174	Polyps	Polyps	regeneration day39	not recorded	SRP199550	96.22
SRR27868179	Polyps	Polyps	regeneration day36	not recorded	SRP199550	95.34
SRR27868207	Polyps	Polyps	regeneration day9	not recorded	SRP199550	95.08
SRR27868208	Polyps	Polyps	regeneration day9	not recorded	SRP199550	93.22
SRR12959205	Polyps	Polyps	E2 day15	not recorded	SRP199550	91.34
SRR12904786	Polyps	Polyps	not recorded	not recorded	SRP199550	90.84
SRR27868210	Polyps	Polyps	regeneration day0	not recorded	SRP199550	90.79
SRR27940228	Polyps	Polyps	not recorded	not recorded	SRP199550	90.76
SRR27868195	Polyps	Polyps	regeneration day21	not recorded	SRP199550	89.80
SRR27868160	Polyps	Polyps	regeneration day6	not recorded	SRP199550	89.77
SRR27868196	Polyps	Polyps	regeneration day21	not recorded	SRP199550	89.00
SRR27868188	Polyps	Polyps	regeneration day27	not recorded	SRP199550	88.71
SRR12959233	Polyps	Polyps	E2 day3	not recorded	SRP199550	88.06
SRR27868197	Polyps	Polyps	regeneration day18	not recorded	SRP199550	87.43
SRR12959204	Polyps	Polyps	E2 day15	not recorded	SRP199550	87.03
SRR12959231	Polyps	Polyps	E2 day3	not recorded	SRP199550	87.00
SRR27868200	Polyps	Polyps	regeneration day18	not recorded	SRP199550	86.86
SRR27868189	Polyps	Polyps	regeneration day27	not recorded	SRP199550	86.17
SRR12959191	Polyps	polyps	E2 day21	not recorded	SRP199550	85.44
SRR27868178	Polyps	Polyps	regeneration day36	not recorded	SRP199550	84.37
SRR12710851	Polyps	Polyps	OA 2 day3	not recorded	SRP199550	83.46
SRR27940222	Polyps	Polyps	not recorded	not recorded	SRP199550	82.82
SRR27868190	Polyps	Polyps	regeneration day27	not recorded	SRP199550	82.76
SRR12959192	Polyps	Polyps	E2 day21	not recorded	SRP199550	81.97
SRR27868182	Polyps	Polyps	regeneration day33	not recorded	SRP199550	81.69
SRR12959218	Polyps	Polyps	E2 day9	not recorded	SRP199550	81.65
SRR27868159	Polyps	Polyps	regeneration day6	not recorded	SRP199550	81.13
SRR12959219	Polyps	Polyps	E2 day9	not recorded	SRP199550	80.84
SRR12959193	Polyps	Polyps	E2 day21	not recorded	SRP199550	79.60
SRR12710849	Polyps	Polyps	OA 2 day3	not recorded	SRP199550	77.94
SRR27868192	Polyps	Polyps	regeneration day24	not recorded	SRP199550	77.46
SRR27940227	Polyps	Polyps	not recorded	not recorded	SRP199550	77.43
SRR12959220	Polyps	Polyps	E2 day9	not recorded	SRP199550	74.60
SRR12710850	Polyps	Polyps	OA 2 day3	not recorded	SRP199550	71.59
SRR27868165	Polyps	Polyps	regeneration day3	not recorded	SRP199550	70.94
SRR12710860	Polyps	Polyps	OA 2 day9	not recorded	SRP199550	70.20
SRR12710859	Polyps	Polyps	OA 2 day9	not recorded	SRP199550	69.14
SRR27868185	Polyps	Polyps	regeneration day30	not recorded	SRP199550	66.94
SRR12710861	Polyps	Polyps	OA 2 day9	not recorded	SRP199550	66.02
SRR27868183	Polyps	Polyps	regeneration day33	not recorded	SRP199550	65.47
SRR27868199	Polyps	Polyps	regeneration day18	not recorded	SRP199550	63.39
SRR27868184	Polyps	Polyps	regeneration day30	not recorded	SRP199550	60.02
SRR27868186	Polyps	Polyps	regeneration day30	not recorded	SRP199550	58.65
SRR27868193	Polyps	Polyps	regeneration day24	not recorded	SRP199550	47.71
SRR27868175	Polyps	Polyps	regeneration day39	not recorded	SRP199550	39.73
SRR12959232	Polyps	Polyps	E2 day3	not recorded	SRP199550	34.32
SRR12807382	Polyps	Polyps	OA2 day0	not recorded	SRP199550	0.00
SRR12927881	Polyps	Polyps	E2 day0	not recorded	SRP199550	0.00
SRR12959207	Polyps	Polyps	E2 day15	not recorded	SRP199550	0.00
SRR27868181	Polyps	Polyps	regeneration day33	not recorded	SRP199550	0.00
SRR27868191	Polyps	Polyps	regeneration day24	not recorded	SRP199550	0.00
SRR27940225	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR27940229	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR9613488	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR9613516	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR12995717	Severed branch	Severed branch	regeneration day0	not recorded	SRP199550	0.00
SRR12996627	Severed branch	Severed branch	regeneration day0	not recorded	SRP199550	0.00
SRR12996628	Severed branch	Severed branch	regeneration High gene expression	not recorded	SRP199550	0.00

Source: CnidoSite RNA-seq expression matrices (AMURI_TPM, StringTie quantification over 82 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora muricata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	10	amur_s0626.g9.t1	0.754195460904975
Negatively correlated	3	amur_s0022.g29.t1	-0.354028387884458

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora muricata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

Dataset	Tissue / stage	Cells	Cell types	This gene	Marker of
AMURI_regen	Polyps · regeneration	8,721	28	unmapped	–

A gene is in viewer when the dataset ships a per-cell expression vector for it; marker only means it is in the dataset’s ranked marker table but no vector was exported, so the atlas cannot draw it; not in this dataset means the dataset’s own gene-ID table does not list it, so no expression claim can be made for that dataset. unmapped is deliberately weaker still: the dataset has no gene-ID table on CnidoSite yet, so nothing is claimed in either direction. Where markers are listed, the numbers are log2 fold change and the percentage of cells of that type in which the gene was detected.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →