Gene detail

Detailed information of amur_s0374.g5.t1 in Acropora muricata

Genomic Location: sc0000374_pilon:117796...122372
NR annotation: XP_029187847.2, tubulin delta chain-like isoform X1 [Acropora millepora]
Species Acropora muricata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

amur_s0374.g5.t1

TTTGACTTCAAGACTTCATGGCTTGTTCTTTTTTCAGGCGTCACAAGAAATGTGATCACAAGTTGACTTATTTTTGCACGATTTCTTAGTCGACGTGAACTGCCTTTTATTGAACGCTAGCTTTTTTGAACTACAGTATTTTATCGAGAAAACTCAGTTGGCGTGTTAATTTGTTTATTTGATGAAGAAAGTGTCAGCTAACTTTCTCTGTGTATATTCATTCTGATTGGACCACCGTGCACCATGTCATCTATTGTACTATTGGTTGGACAATGTGGAAATCAAGTTGGACATGATCTTATGTCGTTGATTGACACAAGTGACGCCCATCCACTGTGTCACAGAGATGGAAAACTTCGTTGTGTATGTGTGGACAGTGAATCAAAGGTCATTGGTCGCAACTATTGTGACGACACTAGAAGAAGTGCTCTTTATAGGGAAGGAAACATGATATCAGGTCAGAAAGGAAGAGGAAATAACTGGGCGCTTGGTTATCATGGCTTTCACATAGAGACAGAAGAAACATCACTTTTACATCGCACTATGGAATCCTTAAGAATAGAAGTGGAAAGATGTGATAATTATGCTGGCACCATTGTGGTTCACAGTCTGGCAGGGGGGACCGGGTCTGGACTGGGTTCACACTTGGTTGAGGCAATCAGAGATACATACCCCCTGGGTCATGTAATGTCAGCAGCTGTGTCACCTCACGCATCTGGTGATTCTCCTCTACAGCACTATAACTCACTTCTAAGTTTGGCTTCATTGCAACGTCATGCAGACGGGGTGTTGCTCTTCGACAATGATGACATTCTTCGCCATGTTTCTGTGCACAGAGGAATAGTGTCACGGCAGAAAAATGCGGCTTCCATTTCCCTGAAAGACATGAACAGCTACATATCTGCCAGTCTTGCTGGATTGCTTCAACCCCTAGGAAACAAACCCAGACGGATGAAGGGAAATGTGAAAGATAAAGGAAACAGACAGTCATCTTACACAACTAGGGTTAAAGAGCATGGTTTGAAACACAACATTGGAAAATCCAATAGAACAGATCCTATTTCAAGAAGACTGTCATATTCACGTGATGAAACACCAGACAGATCCGATATTCTTGGTGGCAGCTCCTCAGAGAAGCCTTTTGCTTCATATTTGTCTGATGAATATTCCATGAATATGTTGTCTAGTACAACTGATTTAGATACTGATGACGTAATGGCCAGGCAGCCTAGATCAACAGCATCTGCCTTGTTGCGCTATCAAGGGATTGTACGCCCTTCTACCTCAAGGACCGAAAGCTGTCAATCATCATCATTAGAAACTGGAGTGTCGTGTGGAAATGAACCATGGGAAATGTTACATTCAATTTGTCCTGAACCAAATAAGAAATTTGCCACACTGCATCATTTGGCCAAATCCAAAGTATCTTGGGAAGGGCTTACAAACTCACTTCTTCATTCACTCCGTCGATATGACAAACAAGGCGTCCAGTTTTCCACCATCAGCTCGCTCCTTGTTGCCCGAGGTGATTTGGATGGCTCCTTCGCGCAAGAATCAGCAAAGATTGAGGAGAAGTTACGTCTTTCTCTGGGATGTGTCGGTTGGAATCCATTTCCAGTTGATTTCTGGATCAGTCGATATAATCCAGTGGGTCCAAAAGAGTCACAATCACTCACACTTTGCTTGAATTCAACTAAAATAGTAGAGACTCTGACCGACGTCATTGAGAAGTCGCGGGCGATGTTTGACGCAGGTGCTTATTTGCATTGGTTCTGGAAACATGGCTGCTCAAAGAACGATTTCCTGGATGCATTTGACACCTTGGAGACTGTGATAGAGGATTACAAACTTGCATCGCGGTGAAGACAAACACAGGCCGCAGGAAATACTAGCAAGGCAATGGTAGAAAACATTTGCGGGAAAGGTACACGAAGGAAAGTGGATTTCTGGGTAGAAAATCCCACGACCAGGTATCGATACCAGGACATTTTAAAAATCAAATTTGGAAACAACTCCATCGAGATTTCAACTTAGAAATAAACTTTTTTTGAAAAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6DIM3	Tubulin delta chain OS=Xenopus tropicalis OX=8364 GN=tubd1 PE=2 SV=1
Q9H4B7	Tubulin beta-1 chain OS=Homo sapiens OX=9606 GN=TUBB1 PE=1 SV=1
Q39582	Tubulin gamma chain OS=Chlamydomonas reinhardtii OX=3055 GN=TUBG PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008675 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00091 all species →	Tubulin	Tubulin/FtsZ family, GTPase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017975 all species →	Conserved_site	Tubulin, conserved site	Interproscan
IPR023123 all species →	Homologous_superfamily	Tubulin, C-terminal	Interproscan
IPR000217 all species →	Family	Tubulin	Interproscan
IPR036525 all species →	Homologous_superfamily	Tubulin/FtsZ, GTPase domain superfamily	Interproscan
IPR003008 all species →	Domain	Tubulin/FtsZ, GTPase domain	Interproscan
IPR002967 all species →	Family	Delta tubulin	Interproscan
IPR008280 all species →	Homologous_superfamily	Tubulin/FtsZ, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11588 all species →	TUBULIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005525 all species →	Molecular Function	GTP binding	Interproscan
GO:0005874 all species →	Cellular Component	microtubule	Interproscan
GO:0007017 all species →	Biological Process	microtubule-based process	Interproscan
GO:0000226 all species →	Biological Process	microtubule cytoskeleton organization	Interproscan
GO:0000278 all species →	Biological Process	mitotic cell cycle	Interproscan
GO:0005200 all species →	Molecular Function	structural constituent of cytoskeleton	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10390	TUBD; tubulin delta	-	Cytoskeleton proteins	ko04812	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of amur_s0374.g5.t1 across 82 RNA-seq samples of Acropora muricata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

82Samples

52TPM > 0

2Conditions

28.6Max TPM

4.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Polyps	79	52	4.64	28.56
Severed branch	3	0	0.00	0.00

Per sample · hover a bar for the full sample record

Show the sample table (82 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR12959206	Polyps	Polyps	E2 day0	not recorded	SRP199550	28.56
SRR27940227	Polyps	Polyps	not recorded	not recorded	SRP199550	17.53
SRR27868177	Polyps	Polyps	regeneration day39	not recorded	SRP199550	13.11
SRR12786900	Polyps	Polyps	OA 2 day0	not recorded	SRP199550	10.82
SRR12786899	Polyps	Polyps	OA 2 day0	not recorded	SRP199550	10.80
SRR12786901	Polyps	Polyps	OA 2 day0	not recorded	SRP199550	10.72
SRR27868160	Polyps	Polyps	regeneration day6	not recorded	SRP199550	10.03
SRR27868158	Polyps	Polyps	regeneration day6	not recorded	SRP199550	8.53
SRR27868202	Polyps	Polyps	regeneration day15	not recorded	SRP199550	8.41
SRR27868179	Polyps	Polyps	regeneration day36	not recorded	SRP199550	8.36
SRR12959204	Polyps	Polyps	E2 day15	not recorded	SRP199550	8.10
SRR27940224	Polyps	Polyps	not recorded	not recorded	SRP199550	7.94
SRR12904784	Polyps	Polyps	not recorded	not recorded	SRP199550	7.78
SRR12959195	Polyps	Polyps	E2 day0	not recorded	SRP199550	7.49
SRR27868189	Polyps	Polyps	regeneration day27	not recorded	SRP199550	7.36
SRR27868188	Polyps	Polyps	regeneration day27	not recorded	SRP199550	7.30
SRR12710851	Polyps	Polyps	OA 2 day3	not recorded	SRP199550	7.15
SRR27868205	Polyps	Polyps	regeneration day12	not recorded	SRP199550	7.13
SRR27868174	Polyps	Polyps	regeneration day39	not recorded	SRP199550	7.12
SRR12959217	Polyps	Polyps	E2 day0	not recorded	SRP199550	6.97
SRR12959191	Polyps	polyps	E2 day21	not recorded	SRP199550	6.76
SRR12959218	Polyps	Polyps	E2 day9	not recorded	SRP199550	6.73
SRR12959220	Polyps	Polyps	E2 day9	not recorded	SRP199550	6.61
SRR27868207	Polyps	Polyps	regeneration day9	not recorded	SRP199550	6.44
SRR27868199	Polyps	Polyps	regeneration day18	not recorded	SRP199550	6.38
SRR27868194	Polyps	Polyps	regeneration day21	not recorded	SRP199550	6.38
SRR12959219	Polyps	Polyps	E2 day9	not recorded	SRP199550	6.23
SRR27868197	Polyps	Polyps	regeneration day18	not recorded	SRP199550	6.19
SRR27868203	Polyps	Polyps	regeneration day15	not recorded	SRP199550	6.14
SRR12959205	Polyps	Polyps	E2 day15	not recorded	SRP199550	6.09
SRR12710849	Polyps	Polyps	OA 2 day3	not recorded	SRP199550	6.09
SRR12959192	Polyps	Polyps	E2 day21	not recorded	SRP199550	5.77
SRR27868200	Polyps	Polyps	regeneration day18	not recorded	SRP199550	5.76
SRR12710860	Polyps	Polyps	OA 2 day9	not recorded	SRP199550	5.72
SRR12959193	Polyps	Polyps	E2 day21	not recorded	SRP199550	5.64
SRR27868208	Polyps	Polyps	regeneration day9	not recorded	SRP199550	5.46
SRR12710850	Polyps	Polyps	OA 2 day3	not recorded	SRP199550	5.44
SRR27868195	Polyps	Polyps	regeneration day21	not recorded	SRP199550	5.16
SRR27940222	Polyps	Polyps	not recorded	not recorded	SRP199550	5.09
SRR27868176	Polyps	Polyps	regeneration day3	not recorded	SRP199550	5.02
SRR27868196	Polyps	Polyps	regeneration day21	not recorded	SRP199550	4.97
SRR27868209	Polyps	Polyps	regeneration day0	not recorded	SRP199550	4.96
SRR12904785	Polyps	Polyps	not recorded	not recorded	SRP199550	4.77
SRR12959233	Polyps	Polyps	E2 day3	not recorded	SRP199550	4.56
SRR12710859	Polyps	Polyps	OA 2 day9	not recorded	SRP199550	4.46
SRR12710861	Polyps	Polyps	OA 2 day9	not recorded	SRP199550	3.85
SRR27868210	Polyps	Polyps	regeneration day0	not recorded	SRP199550	3.59
SRR27940228	Polyps	Polyps	not recorded	not recorded	SRP199550	3.59
SRR12904786	Polyps	Polyps	not recorded	not recorded	SRP199550	3.52
SRR12959231	Polyps	Polyps	E2 day3	not recorded	SRP199550	3.47
SRR27868206	Polyps	Polyps	regeneration day12	not recorded	SRP199550	2.73
SRR27868204	Polyps	Polyps	regeneration day12	not recorded	SRP199550	1.81
SRR12807382	Polyps	Polyps	OA2 day0	not recorded	SRP199550	0.00
SRR12927881	Polyps	Polyps	E2 day0	not recorded	SRP199550	0.00
SRR12959207	Polyps	Polyps	E2 day15	not recorded	SRP199550	0.00
SRR12959232	Polyps	Polyps	E2 day3	not recorded	SRP199550	0.00
SRR27868159	Polyps	Polyps	regeneration day6	not recorded	SRP199550	0.00
SRR27868165	Polyps	Polyps	regeneration day3	not recorded	SRP199550	0.00
SRR27868175	Polyps	Polyps	regeneration day39	not recorded	SRP199550	0.00
SRR27868178	Polyps	Polyps	regeneration day36	not recorded	SRP199550	0.00
SRR27868180	Polyps	Polyps	regeneration day36	not recorded	SRP199550	0.00
SRR27868181	Polyps	Polyps	regeneration day33	not recorded	SRP199550	0.00
SRR27868182	Polyps	Polyps	regeneration day33	not recorded	SRP199550	0.00
SRR27868183	Polyps	Polyps	regeneration day33	not recorded	SRP199550	0.00
SRR27868184	Polyps	Polyps	regeneration day30	not recorded	SRP199550	0.00
SRR27868185	Polyps	Polyps	regeneration day30	not recorded	SRP199550	0.00
SRR27868186	Polyps	Polyps	regeneration day30	not recorded	SRP199550	0.00
SRR27868187	Polyps	Polyps	regeneration day3	not recorded	SRP199550	0.00
SRR27868190	Polyps	Polyps	regeneration day27	not recorded	SRP199550	0.00
SRR27868191	Polyps	Polyps	regeneration day24	not recorded	SRP199550	0.00
SRR27868192	Polyps	Polyps	regeneration day24	not recorded	SRP199550	0.00
SRR27868193	Polyps	Polyps	regeneration day24	not recorded	SRP199550	0.00
SRR27868198	Polyps	Polyps	regeneration day0	not recorded	SRP199550	0.00
SRR27868201	Polyps	Polyps	regeneration day15	not recorded	SRP199550	0.00
SRR27940225	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR27940226	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR27940229	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR9613488	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR9613516	Polyps	Polyps	not recorded	not recorded	SRP199550	0.00
SRR12995717	Severed branch	Severed branch	regeneration day0	not recorded	SRP199550	0.00
SRR12996627	Severed branch	Severed branch	regeneration day0	not recorded	SRP199550	0.00
SRR12996628	Severed branch	Severed branch	regeneration High gene expression	not recorded	SRP199550	0.00

Source: CnidoSite RNA-seq expression matrices (AMURI_TPM, StringTie quantification over 82 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora muricata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	20	amur_s0006.g164.t1	0.824276040271901
Negatively correlated	5	amur_s6349.g1.t1	-0.277928676808723

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora muricata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

Dataset	Tissue / stage	Cells	Cell types	This gene	Marker of
AMURI_regen	Polyps · regeneration	8,721	28	unmapped	–

A gene is in viewer when the dataset ships a per-cell expression vector for it; marker only means it is in the dataset’s ranked marker table but no vector was exported, so the atlas cannot draw it; not in this dataset means the dataset’s own gene-ID table does not list it, so no expression claim can be made for that dataset. unmapped is deliberately weaker still: the dataset has no gene-ID table on CnidoSite yet, so nothing is claimed in either direction. Where markers are listed, the numbers are log2 fold change and the percentage of cells of that type in which the gene was detected.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →