Gene detail

Detailed information of anas_s0136.g26.t1 in Acropora nasuta

Genomic Location: sc0000136_pilon:236376...238593
NR annotation: XP_029192625.1, acyl-coenzyme A thioesterase 11-like [Acropora millepora]
Species Acropora nasuta · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

anas_s0136.g26.t1

CAACCAAAACATCATTTATCTAGATTTCTCTAGCAACTTCTCTAGCAGCAACCGCTGCTCTGTAATTGAGCCCGCACTTATTTGCAGTTGAAGACAACAACTTCGCAATAATTCTGGAACAACATCAAAGAAAGTAACAAGGACACGTATATTTAGCAAAAGAACAGAACCGAAGTTTGTAGAGACAAAGAAATCTGTAAGGATAGAAGAGCTGTCACCATGAATTGTTACAAAAACGCCACAGATGTGGAAATGAATCAGTTGGTTCTTCTGACGCACACAAACGAACGGGAGAAAAACTGCCTGAGCTGTGGACAGCTGCTGAAATGGATGGATACAGTTGCTTGTCTGTCTGCAGAGAAGCACGCTGGGTCATCATGCGTCACGGCGTGCATGGACGAGCTCTACTTTGAAACTGAAATTTTCGTTGGCCAACTTGTTAACCTCACAGCTCGGGTAAATCGAGCATTCAACACGAGTATGGAAGTAGGCGTTTCTGTTCATGTGGAAGATTTGCAAAGCGGGGATAGAAAGAATGTCTGTCAGGCGTTTTTCACTTTTGTAGCTTTAGATGAAAATAATCACAAACAGCAACTGACGCCAGTTGTTCCGTTCACTGTTGAAGAGAAATCGCAGTACGTGCTCGCCATGGAGAGAAGACGAATGCGAATGCAGTACTCTTTCAATCTCAAAGAGCTTTCACTGAAGCACGACAGTGAGATAGAAAGGGACTGGTTTAATAAAGGAGAAACAGGTGTCAATACAGACACTGCATTGGAAAGTGTCGAGCTTGTCCTTCCGCCGCATGCAAATCATCACCAAACAGCGTTTGGGGGTCAAGTGATGGCTTGGATAGCAACAGCTTGTACGATCGCGGCTGCACGCTTGTGCAGATCCACTCCGCTACTGCGAGCAGTCGACGAGTTGAGGTTTCGAGGTCCAATCAAAGTTGGAGACCGGGTGGTCATTAAAACCATGGTGAATAACACCTTCGAGCAGCACATGGAAGTAGGTTGCAGAGTCGAGGCTTACGCAATTGGAGGCGAGCTGCGACACGTCAATAGCGCTTTCTTGATTTTCATGGCTCCTGATGAAAACGGCGTCCCTAAGACTCTGGCACCCCTAGGAGCGAACACCGAGGATGGCAAGCGACGCGCTGTAGAGGCTGTGGCAAGAGAGCGACTGCGCTTTGAGCGAGAGCAGATCCGTAAGTCTGTTGGTCCTGTTATCGCAATTCCTTGGAGTCCTCGTATCGGTCATCTTCTGAATTACAATAATATAGAGACGCTGGTGAAGCTTTATGAACTGACAAAGTGGGAAGAAGTGCTATCTTCTTCAGGTGTCACGGTATTCAAGCGTGACACTGACAACTATCTTTGCGTGAAGGTAATTTTTCATTTACAGGTCCCTCCCGGTAAAGCCTTCGCGTTACTCAAGGATGAAAGGAGGAGAAAGGAATGGGATCCGCTGCCAGTTAAAGTAGAGGTAGCTGAAGTTGTCGATGATGATGACGAGATTGTCTACATAGTGTTGAAGAGCCCGGAGCGCAACGCAACGAAACCAGATGATTTTGTGTTATTAGTGTCACGCAGAGTCCCATGTGATAAGAGAGACTACTTCACCATTGCTTATCGATCGGTCTTGTTAACAACAATACCCCCAGTTCCCGATTATAACCGGAAAGAGCATCTGTGCTCTGGAATGCTCATTTCCGAAACTGACGGAGACCCGCATAAAGCTACCATAACATACATTAATCAAACTACGCGAGAACTGGAGCCTTACGTTATGGGGGATCTTGATGGCTCGACCAAGTTTTTCGCCAAGCGTTTCAAGGAACTCGAGACGTGCATTCTGAAGGAATTGCCCAAGTAAAACTTGGATGGATGCATCCGCTATTTTTGTAATGTACTCTCTATAAGTCGGTTTTGAACATATATTTTGGTTCACGTAATGATAGCTTTGTTTCTAGACTCATTTTGTGAGAACCAACAGTATAGGAGATCACCGTTGTGGATGTCTACGTGGTAAACCTCGGTGCACGAGGAGTATGGACGATGCATGACAAACTTGTTCGCAGGACTTCTCCCTTCGGTGGAGCTTTTTGGTAACGGAGAGGAGACGCGTGATTCCCCTAAAAAGGCCTGGGGACGAGGAACATGTGAAGAAAACGTCTAGGGAGGAGTGAGACGTGCTCCACTAAAACTTGACCGTAAAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8VHQ9	Acyl-coenzyme A thioesterase 11 OS=Mus musculus OX=10090 GN=Acot11 PE=1 SV=1
Q8WXI4	Acyl-coenzyme A thioesterase 11 OS=Homo sapiens OX=9606 GN=ACOT11 PE=1 SV=1
Q9DBK0	Acetyl-coenzyme A thioesterase OS=Mus musculus OX=10090 GN=Acot12 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0008313 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01852 all species →	START	START domain	Domain	Interproscan
PF03061 all species →	4HBT	Thioesterase superfamily	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR040170 all species →	Family	Cytosolic acyl coenzyme A thioester hydrolase	Interproscan
IPR002913 all species →	Domain	START domain	Interproscan
IPR006683 all species →	Domain	Thioesterase domain	Interproscan
IPR029069 all species →	Homologous_superfamily	HotDog domain superfamily	Interproscan
IPR023393 all species →	Homologous_superfamily	START-like domain superfamily	Interproscan
IPR033120 all species →	Domain	Hotdog acyl-CoA thioesterase (ACOT)-type domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11049 all species →	ACYL COENZYME A THIOESTER HYDROLASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006637 all species →	Biological Process	acyl-CoA metabolic process	Interproscan
GO:0016790 all species →	Molecular Function	thiolester hydrolase activity	Interproscan
GO:0047617 all species →	Molecular Function	fatty acyl-CoA hydrolase activity	Interproscan
GO:0070062 all species →	Cellular Component	extracellular exosome	Interproscan
GO:0008289 all species →	Molecular Function	lipid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12417	ACOT11; acyl-CoA thioesteraes 11	EC:3.1.2.-	Lipid biosynthesis proteins	ko01004	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora nasuta tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora nasuta, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →