Gene detail

Detailed information of asel_s0001.g283.t1 in Acropora selago

Genomic Location: sc0000001_pilon:3126329...3132488
NR annotation: XP_029189968.1, WD repeat and FYVE domain-containing protein 2-like isoform X2 [Acropora millepora]
Species Acropora selago · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

asel_s0001.g283.t1

GTTAAAGGGAAACCAAGATGGCTGCCACGATCAGAGATCGTCTGGAGGAGGATGTCACAACAAAACGATCGCGAAAACATCTGAAAGCTGTTCTTGTGAACAAACTGGAAGGATGTAGCGATACGGTTAATATGGCAGTTACAATCCCACACGAGGATGCTGTCATCAGCGTTTCGGATGACAAAAGTATAAGGCTTTGGATAAAACGAGAAAGTGGACAGTATTGGCCCAGCATTTGTCATGTTATGGAATCTGCATGCTCTGCATTAGATTATCATGGAACAAGTAGAAGATTGTTTGTAGGGCTGGCCAGTGGCACCATTTCGGAATTTCAAGTAACTGAAGACTTCAACAGACTCCACCACAAAAGGAATTATTTAGCACACATGAACAGAGTAACCCGCATAAACTTTTCACTTGAGAATGAGTGGCTGCTGAGTACAGGAAGAGACAAATACCTGCAGTGGCATGACTGTACAACAGGCAAAAGATTGGGTGGATATCAGACAGAAGCATGGTGTACATCCCTCCAATTTGATGCAGAGTCTAAGCATGTATTTGTTGGTGACTATGGGGCTCATATAAGCATTATCAAACTGGAAAATAATTCACCATCGCTAGTCACAACGCTCAATGGTCATTCAGGGAGTGTACGAGCCTTGGCATGGGATCCTGATAAAAGGCTCCTGTTTTCTGGTAGTTTTGATGAATCTATTATCATTTGGGATATTGGAGGAAACCAAGGAACTGCATTTGAGCTTCATGGACATTTATCCAAAGTACAAGATTTGTGTTATGCCCCACATGCCAAAAAGTTGATATCCTGCAGCGAAGATGGAATTGTTAGAATATGGGACATGAATGTTAAACGTCAAGAGACACCAGAATGGTCACAAAGTGATGTTTGCGAAAGATGTGGTGGTCCATTTTTCTGGAATTTTAAAGCTATGTGGAGCCAGAGAGCAGTTGGTGTCAGACAGCATCATTGTCGAAAGTGTGGCAGAGCAGTGTGCAATGACTGTGGTGGCAAAGAATCAAGTTATCCTATCATGGGCTATGAAAATTCAGTTCGTATGTGTGTTGAATGTCATGAATCTGTTACAGATGATGAACGATTACCTCTGGCAGATTTGCATGATGCAAAACACACAACACGTTCAATGCACTTAGATTTGACTAAAGGAAGATTACTGACCTGTGGTGGTGATAGGATTATTAAGATTTGGGATATTAAAGCAATTCTATTGTCTTGAAGGAAAGCTGCTACAAGATGTAGTTAGACAGTGATTAAGACTGAGTGCCAATAAAACAAGATGGAAAGCAATAGTGTAGTGATCATTCCTCTTGGAAGAGAACTCTTAATAGGGAGAAAGTTTGTGGCACAATGGACTTGAGGGGATGGGATGGAGGTTTGGGGTTTTCCTTCCCCTCGTGTCTCATAGGCTGCTTTACAAACCCAAAATCCCTACTACTTGATATTATGATTATATTTTCATTGTAGTTCTCTGCATCAGATGAAATAATTCTCTGTTTTGGTAGAATACTCAAATTAATTTTGCTTTAGACCAAGGTAACTTCATTCCACACATCAATGCACTGTTCACTGAGTTTTTCCTTCTCACTCATTGATAGGTTCATATTCACGATTATTATAGTTCTCGGCTACTTTCATAATTGAAATTGACTTTGTACAAATAGGGTTAGGGTTTGCTTTATAGAGATTGCCATGAAAGCTCCAGTATGCTGCTACTGTAAAGTGTATTAATTTTTTAAAAGACTAGCTTTGTGACAGAAGAAAATACAAAAAAAGTCTGAGGTGGTAGAGGATTGAATAATTATTGTTCTTAACAAGAGGTTTTGAAAACATGTGCAGTCACTCCTTAGGTTGTATCATCTGTGATGCAAGAAATTTATTTTTGCCTTTTGAGACTAAGTTATGAATTAAAACTGCTAATCACATTACATTCACATGCACTCAGGAAAAAAAAAACAAATTAGGATTTACTAGTAAAATGGACCATGGACTGTAAGAGATGTCTTTATAACAGATTTGTGAAAAAAAAACAATGAGTATTGTCATTAAAACCTGTTTTAGGTT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96P53	WD repeat and FYVE domain-containing protein 2 OS=Homo sapiens OX=9606 GN=WDFY2 PE=1 SV=2
Q8BUB4	WD repeat and FYVE domain-containing protein 2 OS=Mus musculus OX=10090 GN=Wdfy2 PE=1 SV=2
Q8IWB7	WD repeat and FYVE domain-containing protein 1 OS=Homo sapiens OX=9606 GN=WDFY1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005603 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01363 all species →	FYVE	FYVE zinc finger	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR019775 all species →	Conserved_site	WD40 repeat, conserved site	Interproscan
IPR000306 all species →	Domain	FYVE zinc finger	Interproscan
IPR017455 all species →	Domain	Zinc finger, FYVE-related	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR042234 all species →	Family	WD repeat and FYVE domain-containing protein 1/2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46189 all species →	LD41958P	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0005769 all species →	Cellular Component	early endosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for asel_s0001.g283.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of asel_s0001.g283.t1 across 24 RNA-seq samples of Acropora selago. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

24Samples

22TPM > 0

1Conditions

49.6Max TPM

36.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
coral larvae	24	22	36.16	49.60

Per sample · hover a bar for the full sample record

Show the sample table (24 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR14308015	coral larvae	coral larvae	not recorded	not recorded	SRP315987	49.60
SRR14308012	coral larvae	coral larvae	not recorded	not recorded	SRP315987	47.24
SRR14308024	coral larvae	coral larvae	not recorded	not recorded	SRP315987	46.03
SRR14308011	coral larvae	coral larvae	not recorded	not recorded	SRP315987	45.62
SRR14308008	coral larvae	coral larvae	not recorded	not recorded	SRP315987	44.32
SRR14308022	coral larvae	coral larvae	not recorded	not recorded	SRP315987	41.25
SRR14308017	coral larvae	coral larvae	not recorded	not recorded	SRP315987	40.62
SRR14308005	coral larvae	coral larvae	not recorded	not recorded	SRP315987	40.59
SRR14308027	coral larvae	coral larvae	not recorded	not recorded	SRP315987	40.09
SRR14308004	coral larvae	coral larvae	not recorded	not recorded	SRP315987	39.55
SRR14308025	coral larvae	coral larvae	not recorded	not recorded	SRP315987	39.16
SRR14308020	coral larvae	coral larvae	not recorded	not recorded	SRP315987	39.16
SRR14308019	coral larvae	coral larvae	not recorded	not recorded	SRP315987	39.11
SRR14308010	coral larvae	coral larvae	not recorded	not recorded	SRP315987	38.80
SRR14308026	coral larvae	coral larvae	not recorded	not recorded	SRP315987	38.33
SRR14308007	coral larvae	coral larvae	not recorded	not recorded	SRP315987	36.71
SRR14308014	coral larvae	coral larvae	not recorded	not recorded	SRP315987	35.83
SRR14308016	coral larvae	coral larvae	not recorded	not recorded	SRP315987	35.56
SRR14308006	coral larvae	coral larvae	not recorded	not recorded	SRP315987	34.44
SRR14308021	coral larvae	coral larvae	not recorded	not recorded	SRP315987	34.11
SRR14308023	coral larvae	coral larvae	not recorded	not recorded	SRP315987	32.74
SRR14308013	coral larvae	coral larvae	not recorded	not recorded	SRP315987	28.97
SRR14308009	coral larvae	coral larvae	not recorded	not recorded	SRP315987	0.00
SRR14308018	coral larvae	coral larvae	not recorded	not recorded	SRP315987	0.00

Source: CnidoSite RNA-seq expression matrices (ASELA_TPM, StringTie quantification over 24 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora selago tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	26	asel_s0641.g2.t1	0.933401506400189
Negatively correlated	18	asel_s0884.g4.t1	-0.909471281491285

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora selago, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

DNA methylation (bisulphite samples)

Sample	Methylation profile
Coral_Fragment_Parent	open
Larval_Pool_Offspring	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →