Gene detail

Detailed information of asel_s0040.g31.t1 in Acropora selago

Genomic Location: sc0000040_pilon:378306...390666
NR annotation: XP_029200708.2, tumor susceptibility gene 101 protein-like [Acropora millepora]
Species Acropora selago · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

asel_s0040.g31.t1

TGTTCTTGATTGTCAGGAACAGTTCTTGGTGATGTGTTGTGGAAGCTGAAAAACGGTCTTGCGTACATTGTGTATTTTAAAAAATGGCATGGGATGGAAAGTTAAGAAGTATTCTTGGAGGGTATAAACATGCAGACTTTTGTCGGCAAGACTGTATGAGAGCTCTGCATCAATACAAGTACTTGAAACCGGACAAGCAAAAGTTTACACATAATGATGGCCGTGAAGTTGACCTACTTGCTCTGGATGGAATTCTTCCTGTTCTTATTAGAGGCACAACATACAACATTCCAGTGTGTGTGTGGCTGCAAGAGAACCACCCTTACACACCACCGCTGGTATACGTGAAGCCAACGAACAACATGGGAATCTCAGTATCTAAACATGTAGATGCAAATGGCAAAGTCTATCATCCTTATCTTACTGAATGGACTTATCCGAAATCTGACCTTGCAGCCTTGCTTCAACTTCTTAGCTGCATTTTTGCGGAACAAAGTCCTGTTTACGCAAAGCAACCTGAGCCACAGCCACCCAGCGGTTACAGACCTCCACACCAAGGGCAGTTTTCACAGCCTCAATTTGGCAGTTATCCAGCAAATCCAATGGGATCCACGCCATACCCTGTTAGGGGCCCAGGCATAATGCCGGTTCCGATGCCGATGCCAGGTACCAGCCCTAGGATGTCGACTGGAGTCAGACCTCCTTACCCTCCCTTTCCCCAGGCTGGTGGAATTAGTGGGGGTCAATCCACCACGCCTTATCCAGTGAACCAGCCCAACTTTTCAGCAGTCAGCACTCAGCCCTCCTACCGCCCTCACACAGGGTACCCTCCACCTTCGACTTCAACTGGCGCAAACGTAGTGACGTCAAATCCCGTATCAACGTCAAGTAGTAGTAATGACGATGCAGCCGTGAAAGCCTCGCTGCGAACTGCTGTGGAGGATAAGATTAGAAGAAGAACAAAAGCTTTGTTTGGACAAGCGCAGATTGAATTGGACCAGTTGAACAGAACTCAAATGCAGTTGAAAGAGGGAAGTGAAAAGCTTAAGGATATCTTACAAAAACTGGAGAAAGAACAGGCCGATGTAGACAACGATATTAAGCTATTAACGCAGAAAAACGAAGAGATTACAGTTGTTGTTTCTCAGCTAGAAAGCAATTCTTCAAACTTGGACATTGATGATGCGGTCGTGACAACGGCGCCTCTTTACAATCAAATTCTCAATCTTTTTGCCGAGGAAAATGCTGTCGAGGATACCATTTATTACCTTAGCGAATCGCTGAGGAAAGAAGCCATAGACTTGGATCTTTTTCTCAAGAATGTCAGAGTACTGTCAAGGAAGCAGTTTATGCTGCGAGCTTTACTTCACAAAGCAAGGAAAACCGCCGGGCTAAGTGAAGTGGCAGGATAAAGATTATGATGCAGGAAAAAAAAAATCAAATAAAAAAATAGTCGCGATGTCCGACAACGAAACCGTATGTGGCAGTTAAAACTGAAATTTGAAAGTAGAAATGCTCTGTTTAGGATGTTTCTCTGTTGCTTCTCTACCGAATTTCTTTTTAGGTTCTTGGTTCGTTGACATTCGAGGTCGAATTTGCGCAAATTTATATCGATTTTCAGTACTGCGTGGGCCTTCTCTAAGTCGGCACTTAATGCAGATAACGAAGATGTGAAGCACGATTTGATCTAGGCCAGGACGTATTTCACAGCTGATAGAATCTATTGTAGTGTTTTATTATTATTTTGGGGGTGTTTGTAATTTGAAGTTAAGTAGGGTCATTTAAGTGTATCAAAATATTCCTAAAGTATCTTTTGGGTGTAGAGGAACGCGGGCCTTCGCAACTCTGCATGAAAACCCACACTTAACGCCTTGTGTACGTGTCGGTAATGATCACCTCTAGCTAAAGTAAAACTATCTAAAGATGGATTTGTATTTAAGATAAACCGTCTTATTCGGTGATTGAATGTGGTGGATGGCACTGACGTGTGCCATACTTAGCAATAATCTCCGTGGCTTCAAGTTAGTCTTCGGAAGCCGATATGATAAGCACTGGTCGTCTGGCGTTGAGTGACTCGTGGAGGACTTATTAATCTTAAAACTTCTTTATCGAATAACATGATTGCCAGTAAGACTTCGATGTACCGTATCGACGCCACGAAAACTGAAGACATGAACTTTCTAAGGAATTAAAAAAAAATAAAAACATCTCATATGCTGTGCTGATGTTTGGTCAACGTTGCGTTGCACGCAAAAAAAAAAGTGAATGTGCTAGTTATTTCCACTCTAGGTTAGGTAGGTGAGCTTACCCTTAGAACAAACGCTTTAAGCTGAGGATTGTGGTAAAATAAGATTGTTATGATTTTGAGGCAAGCGGTACAATTAAAGCTTTGCGTTTGCT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q99816	Tumor susceptibility gene 101 protein OS=Homo sapiens OX=9606 GN=TSG101 PE=1 SV=2
Q6IRE4	Tumor susceptibility gene 101 protein OS=Rattus norvegicus OX=10116 GN=Tsg101 PE=1 SV=1
Q61187	Tumor susceptibility gene 101 protein OS=Mus musculus OX=10090 GN=Tsg101 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002227 (this species only) · gene tree & orthology
Ubiquitin family	UBD\|UBC-like\|UEV · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05743 all species →	UEV	UEV domain	Domain	Interproscan
PF09454 all species →	Vps23_core	Vps23 core domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008883 all species →	Domain	Ubiquitin E2 variant, N-terminal	Interproscan
IPR037202 all species →	Homologous_superfamily	ESCRT assembly domain	Interproscan
IPR016135 all species →	Homologous_superfamily	Ubiquitin-conjugating enzyme/RWD-like	Interproscan
IPR017916 all species →	Domain	Steadiness box (SB) domain	Interproscan
IPR052070 all species →	Family	ESCRT-I complex UEV domain-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23306 all species →	TUMOR SUSCEPTIBILITY GENE 101 PROTEIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0015031 all species →	Biological Process	protein transport	Interproscan
GO:0036211 all species →	Biological Process	protein modification process	Interproscan
GO:0000813 all species →	Cellular Component	ESCRT I complex	Interproscan
GO:0008333 all species →	Biological Process	endosome to lysosome transport	Interproscan
GO:0043130 all species →	Molecular Function	ubiquitin binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K12183	TSG101, STP22, VPS23; ESCRT-I complex subunit TSG101	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of asel_s0040.g31.t1 across 24 RNA-seq samples of Acropora selago. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

24Samples

24TPM > 0

1Conditions

45.3Max TPM

35.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
coral larvae	24	24	35.82	45.29

Per sample · hover a bar for the full sample record

Show the sample table (24 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR14308027	coral larvae	coral larvae	not recorded	not recorded	SRP315987	45.29
SRR14308004	coral larvae	coral larvae	not recorded	not recorded	SRP315987	44.09
SRR14308018	coral larvae	coral larvae	not recorded	not recorded	SRP315987	43.36
SRR14308008	coral larvae	coral larvae	not recorded	not recorded	SRP315987	43.06
SRR14308026	coral larvae	coral larvae	not recorded	not recorded	SRP315987	41.91
SRR14308024	coral larvae	coral larvae	not recorded	not recorded	SRP315987	39.77
SRR14308013	coral larvae	coral larvae	not recorded	not recorded	SRP315987	39.31
SRR14308012	coral larvae	coral larvae	not recorded	not recorded	SRP315987	38.92
SRR14308011	coral larvae	coral larvae	not recorded	not recorded	SRP315987	37.11
SRR14308006	coral larvae	coral larvae	not recorded	not recorded	SRP315987	36.37
SRR14308010	coral larvae	coral larvae	not recorded	not recorded	SRP315987	35.12
SRR14308023	coral larvae	coral larvae	not recorded	not recorded	SRP315987	34.59
SRR14308022	coral larvae	coral larvae	not recorded	not recorded	SRP315987	34.57
SRR14308016	coral larvae	coral larvae	not recorded	not recorded	SRP315987	34.18
SRR14308015	coral larvae	coral larvae	not recorded	not recorded	SRP315987	34.17
SRR14308007	coral larvae	coral larvae	not recorded	not recorded	SRP315987	33.79
SRR14308017	coral larvae	coral larvae	not recorded	not recorded	SRP315987	33.78
SRR14308021	coral larvae	coral larvae	not recorded	not recorded	SRP315987	32.52
SRR14308025	coral larvae	coral larvae	not recorded	not recorded	SRP315987	32.15
SRR14308019	coral larvae	coral larvae	not recorded	not recorded	SRP315987	31.85
SRR14308009	coral larvae	coral larvae	not recorded	not recorded	SRP315987	31.25
SRR14308020	coral larvae	coral larvae	not recorded	not recorded	SRP315987	30.31
SRR14308014	coral larvae	coral larvae	not recorded	not recorded	SRP315987	29.67
SRR14308005	coral larvae	coral larvae	not recorded	not recorded	SRP315987	22.51

Source: CnidoSite RNA-seq expression matrices (ASELA_TPM, StringTie quantification over 24 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora selago tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	6	asel_s0065.g9.t1	0.849818611350881
Negatively correlated	5	asel_s0147.g42.t1	-0.777959928987559

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora selago, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

DNA methylation (bisulphite samples)

Sample	Methylation profile
Coral_Fragment_Parent	open
Larval_Pool_Offspring	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →