Gene detail

Detailed information of asel_s0221.g13.t2 in Acropora selago

Genomic Location: sc0000221_pilon:236606...248017
NR annotation: XP_044174468.1, E3 ubiquitin-protein ligase RFWD3-like isoform X2 [Acropora millepora]
Species Acropora selago · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

asel_s0221.g13.t2

CTCGTTGTAGTTCAGTAAAGTGGCGCGGGTTGTGAATTTTGAGAATGTTAAGCAAATGAAAATCATAGATATCTTTCACAATGCTAACATTTTAATAGAGATTTTAAAATGACTACGAATCACGCAAACGATGACGATGAAGTGCGCGAAATCAGAACCGAAAACGGAACCAGTGATGAAGATCAAGGAATGGAAATTGACCCTGAAAACGAAAATTTACAGCAAGTTGCCGAAACTAGTGACATTACACAAGCAGTGAATGGTGAACCTTCTGCTCAGGACGATGCATCTTCCACGGAGAATATAACTTCAGAACTGAACCAAGTTGAGCGCACTAGAAACACTACAGAGGCGAATTCGCCTGATGTCTTTGAAATCAGGCCTTCTAAACCTTCCAAAACGAAGTCTTCAAAAGCTACCAAGTCGCCTTTTAAATCTCCAGAGAAAGATGATGACTCACAGTGCTGCCCAATCTGTCTTGAGCCCTGGTCAAATTCAGGATCACACCGACTGGCTTCTCTCAGTTGTGGACATTTATTTGGAAGAAGCTGTATTGAAAGATGGTTGAAATCTAAAGGAGTAAATGAGAAGTGTCCACAATGCAATGCACCAGCAAAAAGAAGAGATATCAGAAATATCTACACAAAAGCAATCAAATCTATTGACACTACAGAACGCGACAGGGCTCTGGCAGATCTAGAAACTGAGAGAGAAGCACGGCAACGAGCGGAAGAACGTGAAGCCAGAGCTCTTTTGCAGTATCAGTTGACCAAAGCAGAATGTGAGAAGTTAGTTGCACGCCTAAGGAACCAAGAGGAACTTGTTTTTAGTTTACAGTCAAAGAAGTCAATGTTGTGCAGTAAGTGTAGCTCAGAATGTGAAGGAGCATCAGCCAGTGTACGCACCTTTGGCCAAAGCACTTCCAGTCAAAGCTCATTGCCACAGAAGTCTTATATTCTCCAAACATCATTTCAAGTTTCACAGGGCGGTGCCAGAGTGCTTGCATTTGACCAGCACCATGCAGTGTTAGTAGTGTCCAAACCATCACCAAATCAGCTCTTTCCTGGCTTTGGTATTGTGAAGGTAAGCTCATTAGATTCCAAACACTGTGAGTTTGTGCGGATTCACCAAAAACCTCTGAAGGATGCTGCATTTAGTTGCCGTGGTGATGGCTTATTACTGACGGCAGCAATGGACAAGACTGTTAGAGTCACAAGTATGCTTAGCAATACTGTTGTGCAAAGGTATGACACACCAGTACCAGCTTGGTCTTGCGCCTGGAATGAATATGATACCAATTACATTTACTGTGGCCTTCAAAATGGAACATGTCTGATATTTGATGTTAGAAATACAGACACATATCTAAAAAGTATCCATAATGAAGCAGGAGGCTCGTGTCCAGTGATATCTGTTGCTCATGTGTCCCCTGACCCACATGGCCTGCTCAGACCTGGGGGAATTCTTGTTTGTAAACTTGAAGGAGCATCATTCTGGGAAAAAACAACAGGAGCTGATTACTTGCCACATACAATGACTCTACCTGAAGGATGTTGCTCCAGTTTGTCCTTTGAACCAACAACTCGTCACTGCTTGTTTTCACTTCGTCCTTCCAAGAAGTTTCCTCACACAAGACATTTGATTTGTCAACTACAAGGAAATGGTATTGGAATATCAACAGCTCGTGCAGAAACAGAAAGGGCACAAAACACTGAAACCAGCGAGCAGGGTAGTCTTTGCACTTGTCAAGCTGTAAACCAATGTGTTGGGGGTCCATCACAAAAGCTTCTGAGCAAATCAAGACTGTTCACTGATCCTGATGATTCCAATGTTTTGATGGTAGCTGCTGGAGACGAGAGCTCTTCATCAACTCTGATCTGGAATGGTAGCAGTGGATCTCAGCTGCAGAAATTACCCAATCAGGGAAAAGAAACACTGGATATTCTTCCATTTGCTGCAAATGGAAGTAACTTTCTAGCCATCATAGATGAACAGAAATTAAATGTTTACAAGTGGCTTTAGGCATGATGCATGAAAATTACCCAATCAAGGAAAAAGAAACACTGGATATTCTTCCATTTGCTGCAAATAGAAGTAACTTTCTCGCCACAATAGATGAACAGAAATTAAATGTGTACAAGTGGTTAAAGGCATGATGCATGGTATCTCTCAATTCAAAGAAAGTCACACTGTACAGTACCTTGGAATTTAAATTGGACACTTTGAAGAATCATTCATGCCAGATGGAACTTATCAAGAGGAATTTGCGAGCTCCAAACAATTTGTAACAAGTTTTTGATGGTAAAATCAAGTAGACATAAGAGAATTATCATTGTGTATATAGGCTGTTTTGTGTTCAATTTTATTGTTTATCAAAAATACTATCTTAGTTTACTATACAATGTAATTATTGTTCTAAACATTGAGTCAAATAAATACCACTCATTTTTTGAAGGATGACACTACCTAAAACTATTTTTTTTAGACTAATGCCTTGAGTACGTAATTTTTCAAAGGGCTGATTTGGAAAAGGGATGAGGATGTCATTCTTACAAGTCATGTATGTCTTGAGTTTAAATATGGTTGTAAAATATAAATATTGTTTTCTGACGGATCTGAATCAGTTCCACAAAATAGATTAAGTTGCAAAAAAATTATCATTAAATAATGCTTTACCCTGCTTTAAAGACTACAAAGGTCAGCAGTTTTCAAAAGGAATTAATGGAACTTAAAAAA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A0A1L8GLK3	E3 ubiquitin-protein ligase rfwd3.L OS=Xenopus laevis OX=8355 GN=rfwd3.L PE=1 SV=1
A0A974CYQ5	E3 ubiquitin-protein ligase rfwd3.S OS=Xenopus laevis OX=8355 GN=rfwd3.S PE=1 SV=1
Q8CIK8	E3 ubiquitin-protein ligase RFWD3 OS=Mus musculus OX=10090 GN=Rfwd3 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005211 (this species only) · gene tree & orthology
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 activity RING\|U-box · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13639 all species →	zf-RING_2	Ring finger domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR037381 all species →	Family	E3 ubiquitin-protein ligase RFWD3	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16047 all species →	RFWD3 PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0036297 all species →	Biological Process	interstrand cross-link repair	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K15691	RFWD3; E3 ubiquitin-protein ligase RFWD3	EC:2.3.2.27	Ubiquitin system	ko04121	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of asel_s0221.g13.t2 across 24 RNA-seq samples of Acropora selago. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

24Samples

0TPM > 0

1Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
coral larvae	24	0	0.00	0.00

Per sample · hover a bar for the full sample record

Show the sample table (24 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR14308004	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308005	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308006	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308007	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308008	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308009	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308010	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308011	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308012	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308013	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308014	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308015	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308016	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308017	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308018	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308019	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308020	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308021	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308022	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308023	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308024	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308025	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308026	coral larvae	coral larvae	not recorded	not recorded	SRP315987
SRR14308027	coral larvae	coral larvae	not recorded	not recorded	SRP315987

Source: CnidoSite RNA-seq expression matrices (ASELA_TPM, StringTie quantification over 24 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora selago tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	0	not in this network	-
Negatively correlated	0	not in this network	-

This gene has no edge at all in the Acropora selago network, in either direction — it is not one of the genes the network was built from (the network covers genes with enough expression variation across the transcriptome samples). The counts above are a property of the network, not a failed lookup.

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora selago, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

DNA methylation (bisulphite samples)

Sample	Methylation profile
Coral_Fragment_Parent	open
Larval_Pool_Offspring	open

The DNA Methylation page locates this gene by scanning the bisulphite table, which holds one row per cytosine. For the largest datasets that scan takes a while to return; it does not mean the link is broken.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →