Gene detail

Detailed information of aten_s0013.g167.t1 in Acropora tenuis

Genomic Location: sc0000013_pilon:2110198...2121439
NR annotation: XP_029191838.2, uncharacterized exonuclease C637.09-like isoform X2 [Acropora millepora]
Species Acropora tenuis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

aten_s0013.g167.t1

ATCCTCAGGTTTTCTAAAAACGCGTCCAAGATGGAGGACGTTTGTGAAATTTCAAGAAATCCAAGAAAGCGCAAATCTTCAAGAGAAGAAAGCAATGAAAGACCTTCACCAAAGACTGGTAAAGCTGAGGCCAGAAGACAAAGAGCAAAAAGAGGAAAGAAACGATCGAAACGAAAGAAGGCAAAATGTTATTTGGCACAACATAGACTCATCCCTTCTCCAAGCCATTTATTTCGCATCTGTGGTGCTTTACAACCTCTAAAGATCTCTGATATTCAAGACCTGATTTTGTTTGCTGCACTTCATGAAAAGGAACGTCACCTCACACTTCCAAAATGGTGCAACCAAACTGAAAAAAACAGTATCCAAAAGGTTGTTATAGTTCTTGTGAGTGGAATAGGCACTGCTGAATATGCCAAAAATCAAGACTGTTTTACCCAGTGCAATGCTCTTTTTGATCATTGTGTGGAAACTAACTCCTCAGGGACTGATTTCTGTGTTAAGCTGCCGCATGAGAGGTTACTGACTGTCAATATTCCAAGAAAGGAGTTGGAGGATGCAAGAAAGAAACAAGCACTTGCCCCACAGAATGGTAATAAAGTGTTTCGAAGAGAANGTTTGGAGAGCACGAAAGAGTTTTTCCCTCTAACAATATGGTTCCTCTCAACAAAATCCCATGAGGATACATTGATGATATTAACTGAGCCTCCAATGTATGCAGTTGATTGTGAGATGTGTGAGACAGCAGAGGGGTTGGAACTGACTAGAATCTCAGTGGTTGATGAATCCTTTAACGTTCTCTATGACACACTTGTTAAACCATCCAACCAAATAATGGACTACAAAACAAAATACAGTGGCATTACAGAGGATATGCTCAAGAATGTGACAACCACTTTAGCTGATGTCCAGAAGCGGCTAATCGATCTTTTCCCCTCGGATGCTATTCTCCTGGGGCATTCCTTTGAAAATGATCTTCGCGCTCTCAAGCTGTACCACCAAAGAGTTATTGACACGTCTGTCATTTATCCCTCGAACACAAGTAGTACGTTATTCAAAGCCTCTCTACGCGGCCTTGTCCACAAATATTTAAACAAAGATATCCAAAATGGAAAAAATGGTCATTGCTCAGTCGAAGACGCAAGTGCCTGCATGGAGTTAGTTCAACTCAAGATTGAAAACGGTCCAGACTTTGGGGCGCCTCCAGTCGAAAAGGAAGGGTTGTTCGAGAGGACTTCTCGCAATGGGAAAATAGTTGCCATGCTAGATTATTCAGGAATTCTTCGAAAATTTTGCACTGGAGCGACGCACACCGTCAGCTGTTCTTCGGATGAAGAGATTGTCTCCAACGCTGTGCAGTTAATGCAAGGATCAGAAATACTCTGGGCTCATTTACATGAAGCAGAGATGTTTTTGAAAGAGAACGAGTCCAAAGTGGATGAAGAAAAGGAGAAAAGGCCATTTCCGAGTTCACCAAAGCCTCCATTTCAAAGCGAGGCTAAGTGCGAGGATGTTCTTCAATCTGTGGACAATCGTATCAAAGAAATACACGATACCGTACCAAGCCAAAGTCTGTTGCTGGTGTTGTTCGGCTGCGGTGATTTGTCCCCAGTGAGAAGACTTCAAAGACAGAGGGAAGGCAATCGAACCGAGCTAAAAGAAGCTGTAAAGACTGCAAAGAAGGGCGTGTGCTTTATAAAAGTGACACCAGAAGAAATCGCCGTTCGGGAAGGAATAACTTTGGGGCAAGATTCCGCCAATAAAATAATATTATGAGGAAGGTGTTACTTAACTTCTTTATTTTTATGTTTTACATCATTTCCACGCCAGGACATCGACATGAGGTCGTTTTGAAAGACCTTTTTCCTAGAATCTTAAGCTCACTATCACGTGATGAAGCCATTACCTCAAAAATGAATAATTTGTGTGGGCGAGAATTTTTGTGGACACGAAAAAAAAACGACTGTATCGTAATTATGACAAAGAACATTGGTTTAAGTTTTTCACAAAATTATTAAATGTCAATTTTATTTCCAGAACAAATATTTCTCAGTTTAGCCGACTGGCTTGTTGCTGAAGGATACAGCGTTTGATGGGCGTGAATAATTTTGCTTCAAACAGGGAATTAATTCAGTTCAAGTTAATTGGTTTTAACTATTTACTAATTTGTACAATGTGTGTTCGTGCACTCACGGAGTATTTGCATTAGGCAATATGGACAAGTGAAATCGATTTTGTGATAATAGTCGAAGGAGACATTTATGACCAGGATTTCATTTTCGACAAATTAAGTCGTTTCTGATGAGGTAATGTCGGGCCCATCCTCCATTGTCTGACAGTCGGAGTGAGAGTCGACTCTGCCGGGTGTCACGGGATCGCATTTGCGTAGACCTGAACAGAGCACCGATATCAGAATGGCCTTTTCTGTTTTGCTTTACAAGCTCTAAACAGCTTGCGAGTTTTTTTTTGCTTGAACTAATAAGCTTTGATGACGTACAAACGTGAAGCTAAGAGCTCGTGAAGATTATTGAGTGCGGTCTGCCATTAATCACACGGCACAGAATATAAGCAATCTTGTTTTGTTTGATTGGTTGGTCGAAGATTTCTAGATGTGTAGAAGTACATGCATTTGCCTGAGACAATTTATATTTAATTTAATTCCATTCTTCACGATGATGAGGAACTGTATAATATTCATGACATAGCAATCTTCCCTGTTTGGAAGAAGCTTCTGCTCTTCTGCTGTTCGAGACTTTAAATGAAGAATTTGCTGGCAAGATAGTGCCCAACTGTTTATAAATTCTCTGAATGAAGGAGCATTGTTCTGTCAAACTGCATCGAGCAACGTCCGAAAGCAGCAAATTGAATTGCCTTTTACTATGATGGGTTGGTGCATTTTGTTAGTATCATTTATAACATGCTGTTTTGTTAGGAGCCGTAGGCGCTTTTGTTTTTCGTTGAGGCAAAATCTGTAATGAGACATCTTGCGTATGAATTTCAAATGAACGTTTCGAGAATATTTTTTATCTTTCATCTCGACTGTTACTTATTTCTTATTTCCCTATATCGTTTATGTCAGCCTAAGCAAAACCAGAAGAGAGAACGGTAGCGTATCGCTCAATTTGAATTTTTTTGTCGATATTTCCGCACGCAAATTCCAGTAGATATTTACTACTGTGCTTGTCGTGAATTAAATATCGCCGAAGATT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8L7M4	Small RNA degrading nuclease 5 OS=Arabidopsis thaliana OX=3702 GN=SDN5 PE=2 SV=2
O94443	Uncharacterized exonuclease C637.09 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=SPAC637.09 PE=3 SV=2
P53331	RNA exonuclease 1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) OX=559292 GN=RNH70 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001363 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00929 all species →	RNase_T	Exonuclease	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR034922 all species →	Domain	RNA exonuclease 1-like, exonuclease domain	Interproscan
IPR013520 all species →	Domain	Exonuclease, RNase T/DNA polymerase III	Interproscan
IPR047021 all species →	Family	RNA exonuclease REXO1/REXO3/REXO4-like	Interproscan
IPR012337 all species →	Homologous_superfamily	Ribonuclease H-like superfamily	Interproscan
IPR036397 all species →	Homologous_superfamily	Ribonuclease H superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12801 all species →	RNA EXONUCLEASE REXO1 / RECO3 FAMILY MEMBER-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004527 all species →	Molecular Function	exonuclease activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K14570	REX1, REXO1, REXO5, RNH70; RNA exonuclease	EC:3.1.-.-	Ribosome biogenesis	ko03009	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of aten_s0013.g167.t1 across 40 RNA-seq samples of Acropora tenuis. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

40Samples

39TPM > 0

40Conditions

44.8Max TPM

13.2Mean TPM

By condition

Every sample in this dataset carries its own condition — the source metadata gives each run a distinct treatment label — so this table is effectively a sample list. The per-sample chart below is the informative view here.

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole tissue of branch fragment · BC_2	1	1	14.21	14.21
whole tissue of branch fragment · BP-3_2.7_3	1	1	12.31	12.31
whole tissue of branch fragment · BP-3_1.5_2	1	1	13.66	13.66
whole tissue of branch fragment · BP-3_1.5_3	1	1	10.10	10.10
whole tissue of branch fragment · BP-3_1.5_4	1	1	14.10	14.10
whole tissue of branch fragment · BP-3_1.5_5	1	1	8.19	8.19
whole tissue of branch fragment · BP-3_1.5_6	1	1	9.04	9.04
whole tissue of branch fragment · BP-3_2.7_1	1	1	14.56	14.56
whole tissue of branch fragment · BP-3_2.7_2	1	1	10.91	10.91
whole tissue of branch fragment · BP-3_2.7_4	1	1	14.04	14.04
whole tissue of branch fragment · BP-3_0.77_6	1	1	12.73	12.73
whole tissue of branch fragment · BP-3_2.7_5	1	1	7.61	7.61
whole tissue of branch fragment · BP-3_2.7_6	1	1	10.89	10.89
whole tissue of branch fragment · Heat_1	1	1	11.33	11.33
whole tissue of branch fragment · Heat_2	1	1	9.03	9.03
whole tissue of branch fragment · Heat_3	1	1	8.32	8.32
whole tissue of branch fragment · Heat_4	1	1	9.62	9.62
whole tissue of branch fragment · Heat_5	1	1	7.30	7.30
whole tissue of branch fragment · BP-3_1.5_1	1	1	12.41	12.41
whole tissue of branch fragment · BP-3_0.77_5	1	1	7.60	7.60
whole tissue of branch fragment · BC_3	1	1	11.40	11.40
whole tissue of branch fragment · SC_6	1	1	9.91	9.91
whole tissue of branch fragment · BC_4	1	1	10.63	10.63
whole tissue of branch fragment · BC_5	1	1	8.03	8.03
whole tissue of branch fragment · BC_6	1	1	19.17	19.17
whole tissue of branch fragment · SC_1	1	1	11.76	11.76
whole tissue of branch fragment · SC_2	1	1	17.96	17.96
whole tissue of branch fragment · SC_4	1	1	16.03	16.03
whole tissue of branch fragment · SC_5	1	1	22.95	22.95
whole tissue of branch fragment · BP-3_0.38_1	1	1	32.39	32.39
whole tissue of branch fragment · BP-3_0.77_4	1	1	12.92	12.92
whole tissue of branch fragment · BP-3_0.38_2	1	0	0.00	0.00
whole tissue of branch fragment · BP-3_0.38_3	1	1	44.76	44.76
whole tissue of branch fragment · BP-3_0.38_4	1	1	12.94	12.94
whole tissue of branch fragment · BP-3_0.38_5	1	1	12.99	12.99
whole tissue of branch fragment · BP-3_0.38_6	1	1	14.37	14.37
whole tissue of branch fragment · BP-3_0.77_1	1	1	16.75	16.75
whole tissue of branch fragment · BP-3_0.77_2	1	1	15.33	15.33
whole tissue of branch fragment · BP-3_0.77_3	1	1	10.97	10.97
whole tissue of branch fragment · Heat_6	1	1	10.47	10.47

Per sample · hover a bar for the full sample record

Show the sample table (40 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
DRR550233	whole tissue of branch fragment · BC_2	whole tissue of branch fragment	adult	BC_2	DRP012021	14.21
DRR550264	whole tissue of branch fragment · BP-3_2.7_3	whole tissue of branch fragment	adult	BP-3_2.7_3	DRP012021	12.31
DRR550257	whole tissue of branch fragment · BP-3_1.5_2	whole tissue of branch fragment	adult	BP-3_1.5_2	DRP012021	13.66
DRR550258	whole tissue of branch fragment · BP-3_1.5_3	whole tissue of branch fragment	adult	BP-3_1.5_3	DRP012021	10.10
DRR550259	whole tissue of branch fragment · BP-3_1.5_4	whole tissue of branch fragment	adult	BP-3_1.5_4	DRP012021	14.10
DRR550260	whole tissue of branch fragment · BP-3_1.5_5	whole tissue of branch fragment	adult	BP-3_1.5_5	DRP012021	8.19
DRR550261	whole tissue of branch fragment · BP-3_1.5_6	whole tissue of branch fragment	adult	BP-3_1.5_6	DRP012021	9.04
DRR550262	whole tissue of branch fragment · BP-3_2.7_1	whole tissue of branch fragment	adult	BP-3_2.7_1	DRP012021	14.56
DRR550263	whole tissue of branch fragment · BP-3_2.7_2	whole tissue of branch fragment	adult	BP-3_2.7_2	DRP012021	10.91
DRR550265	whole tissue of branch fragment · BP-3_2.7_4	whole tissue of branch fragment	adult	BP-3_2.7_4	DRP012021	14.04
DRR550255	whole tissue of branch fragment · BP-3_0.77_6	whole tissue of branch fragment	adult	BP-3_0.77_6	DRP012021	12.73
DRR550266	whole tissue of branch fragment · BP-3_2.7_5	whole tissue of branch fragment	adult	BP-3_2.7_5	DRP012021	7.61
DRR550267	whole tissue of branch fragment · BP-3_2.7_6	whole tissue of branch fragment	adult	BP-3_2.7_6	DRP012021	10.89
DRR550268	whole tissue of branch fragment · Heat_1	whole tissue of branch fragment	adult	Heat_1	DRP012021	11.33
DRR550269	whole tissue of branch fragment · Heat_2	whole tissue of branch fragment	adult	Heat_2	DRP012021	9.03
DRR550270	whole tissue of branch fragment · Heat_3	whole tissue of branch fragment	adult	Heat_3	DRP012021	8.32
DRR550271	whole tissue of branch fragment · Heat_4	whole tissue of branch fragment	adult	Heat_4	DRP012021	9.62
DRR550272	whole tissue of branch fragment · Heat_5	whole tissue of branch fragment	adult	Heat_5	DRP012021	7.30
DRR550256	whole tissue of branch fragment · BP-3_1.5_1	whole tissue of branch fragment	adult	BP-3_1.5_1	DRP012021	12.41
DRR550254	whole tissue of branch fragment · BP-3_0.77_5	whole tissue of branch fragment	adult	BP-3_0.77_5	DRP012021	7.60
DRR550234	whole tissue of branch fragment · BC_3	whole tissue of branch fragment	adult	BC_3	DRP012021	11.40
DRR550243	whole tissue of branch fragment · SC_6	whole tissue of branch fragment	adult	SC_6	DRP012021	9.91
DRR550235	whole tissue of branch fragment · BC_4	whole tissue of branch fragment	adult	BC_4	DRP012021	10.63
DRR550236	whole tissue of branch fragment · BC_5	whole tissue of branch fragment	adult	BC_5	DRP012021	8.03
DRR550237	whole tissue of branch fragment · BC_6	whole tissue of branch fragment	adult	BC_6	DRP012021	19.17
DRR550238	whole tissue of branch fragment · SC_1	whole tissue of branch fragment	adult	SC_1	DRP012021	11.76
DRR550239	whole tissue of branch fragment · SC_2	whole tissue of branch fragment	adult	SC_2	DRP012021	17.96
DRR550241	whole tissue of branch fragment · SC_4	whole tissue of branch fragment	adult	SC_4	DRP012021	16.03
DRR550242	whole tissue of branch fragment · SC_5	whole tissue of branch fragment	adult	SC_5	DRP012021	22.95
DRR550244	whole tissue of branch fragment · BP-3_0.38_1	whole tissue of branch fragment	adult	BP-3_0.38_1	DRP012021	32.39
DRR550253	whole tissue of branch fragment · BP-3_0.77_4	whole tissue of branch fragment	adult	BP-3_0.77_4	DRP012021	12.92
DRR550245	whole tissue of branch fragment · BP-3_0.38_2	whole tissue of branch fragment	adult	BP-3_0.38_2	DRP012021	0.00
DRR550246	whole tissue of branch fragment · BP-3_0.38_3	whole tissue of branch fragment	adult	BP-3_0.38_3	DRP012021	44.76
DRR550247	whole tissue of branch fragment · BP-3_0.38_4	whole tissue of branch fragment	adult	BP-3_0.38_4	DRP012021	12.94
DRR550248	whole tissue of branch fragment · BP-3_0.38_5	whole tissue of branch fragment	adult	BP-3_0.38_5	DRP012021	12.99
DRR550249	whole tissue of branch fragment · BP-3_0.38_6	whole tissue of branch fragment	adult	BP-3_0.38_6	DRP012021	14.37
DRR550250	whole tissue of branch fragment · BP-3_0.77_1	whole tissue of branch fragment	adult	BP-3_0.77_1	DRP012021	16.75
DRR550251	whole tissue of branch fragment · BP-3_0.77_2	whole tissue of branch fragment	adult	BP-3_0.77_2	DRP012021	15.33
DRR550252	whole tissue of branch fragment · BP-3_0.77_3	whole tissue of branch fragment	adult	BP-3_0.77_3	DRP012021	10.97
DRR550273	whole tissue of branch fragment · Heat_6	whole tissue of branch fragment	adult	Heat_6	DRP012021	10.47

Source: CnidoSite RNA-seq expression matrices (ATENU_TPM, StringTie quantification over 40 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora tenuis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	23	aten_s0002.g155.t1	0.895493017458758
Negatively correlated	23	aten_s0029.g123.t1	-0.816879464172228

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora tenuis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →