Gene detail

Detailed information of ayon_s0079.g15.t2 in Acropora yongei

Genomic Location: sc0000079_pilon:279834...299865
NR annotation: XP_029194625.2, LOW QUALITY PROTEIN: calcium uptake protein 1, mitochondrial-like [Acropora millepora]
Species Acropora yongei · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

ayon_s0079.g15.t2

AGCGCCATTTTGACTGTGAAAGACCTGAAATGTTGCCCAGCTTTACATATGTTTGCGTGTTGGAATAATTCTTTGTTTTAAATCTTCGTGTAAAAAAGGATAATTCAAGGACCATAATTCATCAATTATGCTCAAGACAATTCCTAGAGTAGCAGTTTTACGAAGACTTGCGTCGGACAACCTGACAAGCAAACAAAACCAAATTTCATGGTATTTCCACTGCGTGAGATTTGCGAGTGCAGACGCCCGAAATCGTACAAGTGGAGAAGATTTTGATCGAGAGGCTTTCAATCTCCGTCAGAAGCGGCTCGTAGCCGCCATTATCGGTTCATCTGTGGGATTGATCGGCTCAAGTTATTGTTTGTACCGGAAACTTAGCAAGGCTAATGCAGGGAGTCCTCAATCTTCCATAAAATATGAAAGAGTGAGTAATGTTGACGAAAGATCCGGTGAGCATGAAAAGGAGAGCGATGAAGACGCTGATGGACAAAAAAAGAAAGAAAAGATAGGATTTAGAGAAAGAAGGATAATTGAATATGAAAACCGTATCAGACAGTACAGCACACCGGACAAGGTGTTTAGATACTTTGCTTCCCTCAAAGTTGTGCGCATTGGTGAAGACAATGAAGTGTTTATGAGGCCTGAAGATTTTGTGAGATCATTAACTCCTGGAAAAGTACAGCCTCCTGGACAGGGACTTGATGAATATGAGAAATTTAACCCAGAGAAGCACAAGTATAAAGGCCACATATCAGACCAGCTGGGTCAAGACAGTGTTTTCATGAAGATGGGAGAATATGGACTTATCTCATTCTCCGATTACATTTTCCTGCTCACAGTTTTATCACTTCCTCCTAGAATGTTTGAAATTGCCTTTCAAATGTTTGACCTAAACGGAGATGGTGAAGTGTCTCCAGCAGAATTTGAAAAGGTGCAAAGCATTCTCTTCAATTTGACATCGACCGGCCTTCGCCATCGGGATCATGCAGTAACAGGCAGTGTTCTCTCCGCTCATGTTAACAGTGGGCTGAAGGAATATTTCTTTGGTAAAAACATGGAAAAGAGACTAACGGCAAAAAGATTTACAGAATTTCAGAGGAAGCTCCAACAAGAGGTCATGCTTTTAGAGTTTCATTCTTATAATCCTCAAGATGGTCGAATTAAAGAATGGGAATTTGCTGATATGCTTTTAACCTACTCCAGTTTTCAAGAAAAGAAGAAGCAAAGAATTCTCAAAAAAGTCAAAAAATCCTTCAAAGGTGATTCCCAGGGAATAGCATTCAAGGACTATTTGGACTTCTTCAGTTTTATGAGAAACATTTCTGAGGCAGATATGGCACTGAGTTTTCATAATGCTGCTGGCAAAGCCATTGATCCTGAAACATTTAAGCAAGTTGCAAGAACAGTAACAGATGTGGAGTTAACTGACAATATTGTGGATGTGGTGTACAAGATGTTTGATGAAAATGATGGTCGAATTAAAGAATGGGAATTTGCTGATATGCTTTTAACCTACTCCAGTTTTCAAGAAAAGAAGAAGCAAAGAATTCTCAAAAAAGTAAAAAAATCCTTCAAAGGTGATTCCCAGGGAATAGCATTCAAGGACTATTTGGACTTCTTCAGTTTTATGAGAAACATTTCTGAGGCAGACATGGCACTGAGTTTTCACAATGCTGCTGGCAAAGCCATTGATCCTGAAACATTTAAGCAAGTTGCAAGAACAGTAACAGATGTGGAGTTAACTGACAATATTGTGGATGTGGTGTACAAGATGTTTGATGAAAATGATGATGGGGTTTTGAGCCACAAAGAGTTTATTGTGGTTATGAAAAACCAGTTGGTTAGAGGACTTGAAAATCCCAAGGACACTGGATTTGGCCGACTCATGCAGGCTGTTTGGCATTGTGCAAAACGTCTCACTTACCAAACCCTTCACCCCAAGAAACTTGCAACAAAAGAAGATTAACATGTTTGAGCTGTGTAAAGGACATTGCGGAATAGCCCAATCAGTGAAAGAGTTTTCGAAAAACTATGTCATTCAGGGATATTGCTTACTCCATTTGGCACTGAGAGGTCCCTCATTGATGGGTCATATTGTTGGCCATAACAGAGAATAATCTGAAAGTGTTCAATTTGTTAAAGAGAGGGTTGAACAAGAAATACAGTGAAAATATTGAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
B1H2N3	Calcium uptake protein 1, mitochondrial OS=Xenopus tropicalis OX=8364 GN=micu1 PE=2 SV=2
A2VEI2	Calcium uptake protein 1 homolog, mitochondrial OS=Drosophila melanogaster OX=7227 GN=MICU1 PE=2 SV=1
Q0IIL1	Calcium uptake protein 1, mitochondrial OS=Bos taurus OX=9913 GN=MICU1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006252 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13202 all species →	EF-hand_5	EF hand	Domain	Interproscan
PF13833 all species →	EF-hand_8	EF-hand domain pair	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan
IPR018247 all species →	Binding_site	EF-Hand 1, calcium-binding site	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR039800 all species →	Family	Calcium uptake protein 1/2/3	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12294 all species →	EF HAND DOMAIN FAMILY A1,A2-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0006851 all species →	Biological Process	mitochondrial calcium ion transmembrane transport	Interproscan
GO:0036444 all species →	Biological Process	calcium import into the mitochondrion	Interproscan
GO:0051560 all species →	Biological Process	mitochondrial calcium ion homeostasis	Interproscan
GO:1990246 all species →	Cellular Component	uniplex complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K22827	MICU1; calcium uptake protein 1, mitochondrial	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora yongei tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora yongei, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →