Gene detail

Detailed information of eanc_s044.g0179.t1 in Fimbriaphyllia ancora

Genomic Location: s044:2726326...2737171
NR annotation: XP_029192273.2, dual specificity mitogen-activated protein kinase kinase 4-like [Acropora millepora]
Species Fimbriaphyllia ancora · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

eanc_s044.g0179.t1

AATATTTTGTTTTCAAGTTCCTTTAGTTTCGAAGATTTCGATAGTTTATCACCCGATTTTATGTTAAGAGATCTAAAGGGACTATTCCCTTATATTTCTGTTTGAAGGTCGTCAAAATTGGACTCAATTTCTGTTGTGTATCCTCTTTTATTCGCTGTTTGGCGGGCATGGCGTCTAATTCTCCCGGGAGCAGATTATCGAGAGAGAAACTCAAGCTAGATTTTCAAGGTGGATTGGAACGCCGAAAATTAAACCTTTCAGCGTTGAGTGCATGTACCAGGCAACCAACACCACTTCAATCAAATATGGAGCGACTAAGAACCCACAAGGCGGTTGGTAAACTCTCATTTGGACCAGATAAGAATTATGAATACTCATCTGAAGACCTGGTTGATTGTGGTGAGATTGGAAGAGGAGCATACGGCACTGTTAACAAGATGCTGCACAAGGAGAGTAACACTTACATGGCAGTTAAGAGAATTCGCTCAACAGTTGATGAAAAAGAACAGAAACAGCTTCTGATGGACTTGGATGTTGTCATGCGAAGTAGCGATTGTGAATACATTGTCAAGTTTTATGGAGCATTATTTACTGAGGGTGATGCCTGGATTTGCATGGAACTGATGACAACATCCTTTGATCAGTGCTATAGGCATATTTATGGTGTCGTCCGTCAAACTATACCGGAGGATATTTTAGGAATGACTTCGTTAACAGTTGTTAAGGCACTGGATTATTTGAAAACCAATCTCAATATCATTCACAGAGATGTGAAGCCCTCCAACATCCTCTTAGATCTCCAAGGAAATATAAAATTATGTGACTTTGGCATCAGTGGCCAACTTGTCGACTCCATTGCCAAAACCAGAGATGCTGGATGCAAGCCTTACATGGCGCCTGAAAGAATAGACCCCATGTCTTCAAGACAGGGCAGTTATGACATCAGATCAGATGTGTGGAGTTTTGGCATAACATTGATTGAACTTGCTACAGGCAAGTTTCCATACCCCAAATGGAAGAGTGTCTTTGACCAGCTGAGCCAAGTTGTGAAAGGAGACCCCCCACGCTTGACAAATGAAGAAGGAAGAGCCTTCTCAGACGAAATGCTCTCTTTTACAAATATGTGCTTGACAAAAGATGTAACCAGAAGACCAAAATACCGCGAGCTACTCAAACATCCCCTCATCTTAAGATACGAGGAAAAGCAAGTGGACGTTGGAAGATGGCTTAGTGGAGTTTTGGCGCAGGCGCCTTTGCAAAACTTTGATAAATTAGAGATATGATGTCTTTATACGATACTATTTTTGCACAAATGAAATTATGTAAATACTTGAAAACGAATATGACATTGTCTTTGTTGAGTATACATTGTACAATTCAGTGATGTATGCTATACCCACGTATGCCTCTCGAACAATTTTTTTCTCGACAAATTTTGGACATTGTTTTGGAATCTGCCCCTTTCATAGCTCACTTTTACCCCTTTTTCTGCGTCAGAGGTAAGCCTGTAACCTTCGGTGCGAAACGTATTCGTTGCATTGTAATTTTCGCCGGGACTTGTCGCTAATTTTCAGCTGCAATTCCAAATGCTTGAATTTCATTGCTTTCCTTTAGGTTTAAGTTTTGTTTACAGAGTTACATGTACCAAAGATCTCTTTCGAAAAACTTCGTTGAGTGGCAAAAGTAACAACGCATACATGTAGCACTGTGAGAACGGGGATTAGTTTATTGTAGTACATGTAATGTTTAGCCTTCCCACTATAATTATTTGAACTTCGTTTTGCAGACAATTGATTGTTTTTCTTTATCTGGGTGTTATCAGCTGTTATCGTAGCCTTCAGAAGGGTACTTACTGCTAGATACACGTACGCTTATGTTTGCTAGTCTACTGTTTTGTTGGCCCGGGAACAAGACGTTCCGCTACTAAAGGACTCGCTGTTTCTTCATTTCTCACCTGTAGGGCGTGAAATACAAATTCAAATGTCTTTTAGACTCAAATTGCCTTAAAACCACAGCTAACAGTGCAGAGAAGTAATTTACTTCAGTAAAGGGCCTTTATCTCTACCATAAAGTCATGTCTGCGTAAAGAAAGACCAACAATGCTGTTTCTTAATTTCTAGATTGATCAGATTGGCGGGAGGCTTATGATTAGGTCCTTAGGCATCTAGACGTTTCACTTAGCTTTTTGTATTTGCTAATTTAATGTAAAATATTATTGGTGAATGGGCGTTTATGCTAGAATTGTTTGCTGTTGTGTTTTTATTATATTTTGCTCATTTTGCCTCTCTCCTTCGAAAAAAAAAATAAATCAAATTTAGATGGTAAATAACCCCTACTGAGTCGTTAACTGCCGCTATTTTGCTTTTGTATTACGATCTGTAATTAATTCCTAAGCGACAATGTTCCAGAGAGTCAAATCAATGTAAAATTTCATGAACATCAATAAGGAAAATATATATTTTTAACGACATGATCGACAGTTGGAGTTGTGGAAATTTAAGTCTCCGTCCAAGTCCTCATGGGATCGAAGACCTCTCTTGTAAACCACTGCAGTTTCACTTCCATAAGAAGTAAGCTGTCTCACTTTGATTTGTTATAATATATTTATTAAGGAATAAGATTTAAAGGCCATTAAAGCGACTGTTAAAAT

Transcript

eanc_s044.g0179.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P45985	Dual specificity mitogen-activated protein kinase kinase 4 OS=Homo sapiens OX=9606 GN=MAP2K4 PE=1 SV=1
P47809	Dual specificity mitogen-activated protein kinase kinase 4 OS=Mus musculus OX=10090 GN=Map2k4 PE=1 SV=2
Q07192	Dual specificity mitogen-activated protein kinase kinase 2 (Fragment) OS=Xenopus laevis OX=8355 GN=map2k2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001218 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48013 all species →	DUAL SPECIFICITY MITOGEN-ACTIVATED PROTEIN KINASE KINASE 5-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0000165 all species →	Biological Process	MAPK cascade	Interproscan
GO:0004708 all species →	Molecular Function	MAP kinase kinase activity	Interproscan
GO:0008545 all species →	Molecular Function	JUN kinase kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04430	MAP2K4, MKK4; mitogen-activated protein kinase kinase 4	EC:2.7.12.2	Protein kinases	ko01001	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of eanc_s044.g0179.t1 across 18 RNA-seq samples of Fimbriaphyllia ancora. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

15TPM > 0

4Conditions

102.8Max TPM

47.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
ovaries	11	8	41.12	91.71
testes	5	5	43.13	54.33
Tentacles	1	1	80.42	80.42
Mouth and pharynx	1	1	102.76	102.76

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
DRR235374	ovaries	ovaries	oocytes with cytoplasmic polarization\, <125 um in diameter	not recorded	DRP006537	91.71
DRR235383	ovaries	ovaries	oocytes with 'U'-like germinal vesicles\, >276 um in diameter and GVBD	not recorded	DRP006537	86.76
DRR235378	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 201-275 um in diameter	not recorded	DRP006537	50.54
DRR235382	ovaries	ovaries	oocytes with 'U'-like germinal vesicles\, >276 um in diameter and GVBD	not recorded	DRP006537	48.76
DRR235381	ovaries	ovaries	oocytes with 'U'-like germinal vesicles\, >276 um in diameter and GVBD	not recorded	DRP006537	48.68
DRR235376	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 126-200 um in diameter	not recorded	DRP006537	47.26
DRR235377	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 126-200 um in diameter	not recorded	DRP006537	44.40
DRR235372	ovaries	ovaries	oocytes with cytoplasmic polarization\, <125 um in diameter	not recorded	DRP006537	34.27
DRR235375	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 126-200 um in diameter	not recorded	DRP006537	0.00
DRR235379	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 201-275 um in diameter	not recorded	DRP006537	0.00
DRR235380	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 201-275 um in diameter	not recorded	DRP006537	0.00
DRR235389	testes	testes	spermatogonia and primary spermatocytes	not recorded	DRP006537	54.33
DRR235386	testes	testes	spermatogonia	not recorded	DRP006537	53.67
DRR235384	testes	testes	spermatogonia	not recorded	DRP006537	40.61
DRR235387	testes	testes	spermatogonia and primary spermatocytes	not recorded	DRP006537	36.57
DRR235385	testes	testes	spermatogonia	not recorded	DRP006537	30.45
DRR397929	Tentacles	Tentacles	not recorded	not recorded	DRP011835	80.42
DRR397944	Mouth and pharynx	Mouth and pharynx	not recorded	not recorded	DRP011835	102.76

Source: CnidoSite RNA-seq expression matrices (FANCO_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Fimbriaphyllia ancora tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	11	eanc_s012.g0189.t1	0.852577663615961
Negatively correlated	47	eanc_s081.g0022.t1	-0.868520563994235

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Fimbriaphyllia ancora, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →