Gene detail

Detailed information of eanc_s080.g0034.t1 in Fimbriaphyllia ancora

Genomic Location: s080:544793...585421
NR annotation: XP_044171236.1, signal peptide peptidase-like 2B isoform X2 [Acropora millepora]
Species Fimbriaphyllia ancora · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

eanc_s080.g0034.t1

TTTGAACATGGTGCGCATTTTTTTAAAGTATAAGTAGTAGAAGAAAATATCAATAGCTTTCTTGCTGTCGATAGCTCATAAGCTATTACTGAGTTACTTACATTTCTTCGTGTTTCTGGCTCAGCTGAGCTTCTCGAGCATGCCATTTTGCATGCTTCAACTGCTCTTAAGTAATTGATTTTATTGATATGGTGACTATATGGTGCCCTACCATGAATTATATGCCCGTCCATGCCACGGAAACTCATATGCGGGCGCAAGAGAAAACAGTGGCCCAAATACTACGTCACTAACACTTACATGAACTGTCTCTCAACCTGAAGACAACTTTGAAGATGGTGGAGAATACCGTTCGCTTTCTAATTGTTGTGGTTTTCACTTCTCTTGTGAGGCAGGGGCATGGACAAGATGTTGGTAATCTGGGTGTTCTCCATGTCGAAGGGACGGAAGATTCGCAAGATTTTTGTATCGCTTATAACAAGAATTGGCCGGGAATAAGCCTTCCAGTGGAACTTGATAAGACGCCCAAATATTCACTGGTTGAAGCCAACCCACCTCTTCTATGTGAGCCAACTCAAAACTCGTCAGATATGAAAAATGCTGCTGTTGCTATTAAAAGAGGAAACTGCACATTACTTATAAAGGGATTTTTTGCACAAACGTTTGGAGCAAAAGAGGTCATTATTGTTAGTAATGACACATTGTTTTTTCCTGATGGAAATTTAACAGCTAAACTTGACATCCCCTTAGCAGTAATCAGTAAAGATGACTGGACCAAACTTAAGAGCAAGGATTTTGGTAAAGATGTTAAAGTACAGATGTATGCCCCTCTGACAGCCAACATTGATGGCAATCTAGTTATTTTGTGGCTGCTAGCAGTGTGTACTGTGGCTGTTGGTGCCTACTGGGCTGGAGTCTCCAATAAGAAGGCTATAAGTGGTTTGATACGACGAAATGCTTCTGCAAGTGGAGATGATGCAAATGGGGAAAGACAAGATGATGATGCTTCCCTTGAAGTTACCCCTCTGATGGTGGTGATATTTGTGATTCTCATTTGTGGCACTCTGCTGTTGCTGTTCTATTTCTATAATTACTTGGTGTATGTGGTGATTGTGCTGTTTTGCCTGGCATCCTGCAATGGATTTTATGAGTGCATGAGACCCATTATCCTGTGCCTTCCTCTTGGAGACTGTAAAGTTCCACCGAACCGGATTCCACTGCTTAAAGATCAGCCGCAATTTAGGATTATTTTGTTAATAGTCTTCAGCATGGCTTTGTCAATCTGGTGGGGTATTGAGAGGAACAAAAGTTATGCCTGGGTCCTCCAAGACATCCTTGGAATCACATTCTGTATTAGCCTTATCAGAAACATTAGACTGCCAAACCTGAAAGTTTGCACCATTCTGCTGGTGCTGCTGCTCATTTATGACATATTCTTTGTGTTTATTACACCTTTGTTCTCTGCTGGGAAAAGTGTGATGGTGGAAGTTGCTACAGGAGCTGGAAGTAAGGAGCAGTTACCAATGGTTCTTAAGGTGCCTAGGATTCAAAGATCATCACTGTCTGTGTGCCTCAGGCCTTACTCCTTACTGGGTTTTGGGGACATTCTTGTGCCCGCCCTGTATATTGGATTTTGTCACACATTTGACATCATGTCAAAGACTCCTTACAAGATATATTACATTTCAACAACCATAGCTTATGGTGCAGGTCTGCTTATCACATTTGTGATGCTGTTTGTGATGGAAAAGGGACAGCCTGCTTTACTCTATTTAGTGCCCTGTACTTTGATTACTGGTTATGTGATTGGCTGGCTGCGTGGTGACCTCAAGAAACTTTGGACTGGACGAATGTTTCCTGATGATGATGGATTGACAGATGATCAAGAAGAAGATGAAATTTGTAGAAGTGGACATGTTCAAAACAGTAATCCGAATGAACTGGAAACTCAAAGACTTATAGGTGGCGAAAATTAAATAACAGGAAATAAACTGGAATCTTGTAGATTGGTCAAGATTCTAAGGACTGTTTAAAAGTTAAATGTCTACAGTAGATGTATATATATTAGTGATAGTGTTTTGCTACAACTGAAATGTATTTTGCCAGGGTAGGATCATATATTTTACTTCCATCTGTGTTTCAAAAATGGTGTGGTGTTTATTTTTTGGGATAGAAATAAATAATGTGGCCTAACTTCCTTTTTTTTTTCAGGGGCCTAAACAATAATAAAAAACGAATGCTAGCAAATGCATTTGACTTGTCTTAACTATCTCAAATGGTGTTGGAAAAGTTAGGGCACATTAATATTTTGGTGGATGTAATGTAGAGGTCACTAACTATGTGACAAAGTAATGTCACTGAGAACATCACAAATGGTGGAAGTTAGCTGCAGGAGACATTTTTTAAACTTAAACATTCTTCTAGCATCATTTTCTCAGAGGTAACAAACATACTTGTGAAAATGAGTGTACCTTCCCGCTGGTGTACATAAGAGAGCTACGAAATCCATGTTAGGTATAAAAGGCAAATATGAACAAATTTGGTAAAGGAAGGTGTTCTTGTATAGCTTCAAGTACTAGTTTCAATATGGGCTTTTTGAGAAAATTTAGGTACCTCCCCACAGAAAGTCATTTGCAATTCTGTGTGAATTTGCAGAACTCAAAGCCCTAGTGTTTGCAGGAGGGCCAATCCAAAGCAGCCTCCATTTGTGGAGTATGGTTAGCTTCTGTAAACACAATCTGCTTTCTTTGTCATGCCAGTTGAAAGAAAAACGTCTTAGTCAATTCAATTTCACGAAAAGTTTGAAAGTAAATTCTTTATGGCCACAAATATGACAAGGTGGTGAAGGAGAG

Transcript

eanc_s080.g0034.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5F383	Signal peptide peptidase-like 2B OS=Gallus gallus OX=9031 GN=SPPL2B PE=2 SV=1
Q8TCT7	Signal peptide peptidase-like 2B OS=Homo sapiens OX=9606 GN=SPPL2B PE=1 SV=2
Q3TD49	Signal peptide peptidase-like 2B OS=Mus musculus OX=10090 GN=Sppl2b PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005313 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04258 all species →	Peptidase_A22B	Signal peptide peptidase	Family	Interproscan
PF02225 all species →	PA	PA domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006639 all species →	Family	Presenilin/signal peptide peptidase	Interproscan
IPR007369 all species →	Family	Peptidase A22B, signal peptide peptidase	Interproscan
IPR003137 all species →	Domain	PA domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12174 all species →	SIGNAL PEPTIDE PEPTIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0042500 all species →	Molecular Function	aspartic endopeptidase activity, intramembrane cleaving	Interproscan
GO:0005765 all species →	Cellular Component	lysosomal membrane	Interproscan
GO:0030660 all species →	Cellular Component	Golgi-associated vesicle membrane	Interproscan
GO:0033619 all species →	Biological Process	membrane protein proteolysis	Interproscan
GO:0071458 all species →	Cellular Component	obsolete integral component of cytoplasmic side of endoplasmic reticulum membrane	Interproscan
GO:0071556 all species →	Cellular Component	obsolete integral component of lumenal side of endoplasmic reticulum membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09597	SPPL2B; signal peptide peptidase-like 2B	EC:3.4.23.-	Peptidases and inhibitors	ko01002	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of eanc_s080.g0034.t1 across 18 RNA-seq samples of Fimbriaphyllia ancora. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

18Samples

13TPM > 0

4Conditions

64.8Max TPM

34.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
ovaries	11	8	36.73	64.81
testes	5	4	36.16	50.86
Tentacles	1	0	0.00	0.00
Mouth and pharynx	1	1	32.89	32.89

Per sample · hover a bar for the full sample record

Show the sample table (18 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
DRR235376	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 126-200 um in diameter	not recorded	DRP006537	64.81
DRR235383	ovaries	ovaries	oocytes with 'U'-like germinal vesicles\, >276 um in diameter and GVBD	not recorded	DRP006537	59.52
DRR235382	ovaries	ovaries	oocytes with 'U'-like germinal vesicles\, >276 um in diameter and GVBD	not recorded	DRP006537	51.50
DRR235378	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 201-275 um in diameter	not recorded	DRP006537	51.02
DRR235381	ovaries	ovaries	oocytes with 'U'-like germinal vesicles\, >276 um in diameter and GVBD	not recorded	DRP006537	47.41
DRR235377	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 126-200 um in diameter	not recorded	DRP006537	46.15
DRR235372	ovaries	ovaries	oocytes with cytoplasmic polarization\, <125 um in diameter	not recorded	DRP006537	44.49
DRR235375	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 126-200 um in diameter	not recorded	DRP006537	39.13
DRR235374	ovaries	ovaries	oocytes with cytoplasmic polarization\, <125 um in diameter	not recorded	DRP006537	0.00
DRR235379	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 201-275 um in diameter	not recorded	DRP006537	0.00
DRR235380	ovaries	ovaries	oocytes with accumulation of yolk and other components\, 201-275 um in diameter	not recorded	DRP006537	0.00
DRR235385	testes	testes	spermatogonia	not recorded	DRP006537	50.86
DRR235387	testes	testes	spermatogonia and primary spermatocytes	not recorded	DRP006537	48.30
DRR235384	testes	testes	spermatogonia	not recorded	DRP006537	45.70
DRR235389	testes	testes	spermatogonia and primary spermatocytes	not recorded	DRP006537	35.94
DRR235386	testes	testes	spermatogonia	not recorded	DRP006537	0.00
DRR397929	Tentacles	Tentacles	not recorded	not recorded	DRP011835	0.00
DRR397944	Mouth and pharynx	Mouth and pharynx	not recorded	not recorded	DRP011835	32.89

Source: CnidoSite RNA-seq expression matrices (FANCO_TPM, StringTie quantification over 18 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Fimbriaphyllia ancora tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	18	eanc_s001.g0040.t1	0.931454116684338
Negatively correlated	12	eanc_s007.g0179.t1	-0.846133403831675

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Fimbriaphyllia ancora, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →