Gene detail

Detailed information of g10292.t4 in Acropora digitifera

Genomic Location: chr5Alt:1147702...1158072
NR annotation: XP_044177635.1, E3 ubiquitin-protein ligase UHRF1-like isoform X1 [Acropora millepora]
Species Acropora digitifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

chr5Alt.g10292.t4

TTGCCATCAAAACATCACATCTTTGGAATGATGCAAGGGTGCTTCTCTTCTTAGAAAGGCGAAATGATAGATGCAAAAGAGCCAACATTAGGTGCCTGGTTTGAAGCGAGAGTAGTCAACACTTCTGTAGCAGATGAAAATGATCCAAGCTCCATTTTGTATCATGTCGTTTTTGATGGATATGAGGAAGATGATATAAATAAACTCCCAGAAAGCTCAATCAGGCCCATTGCAAGGACAGCTCTAACATGGGATCAGATCTCAGTTGGTCAAGTTGTGATGGCAAATTATAACCCTGACGACCCAGATGAGAGGGGATATTGAACCAACACAGATGATACAGTTGCTCAGGAATGTCGACTAAAATTTATAGACAAGGAGATTTTCGTGATTGAAAGTCCTCCAGATCCCAACAGTGCGGAAGCTTTATCTTATCCAAATGAAAAAAATTCACCAGCAAAAAGACAAGTAAAAGCTGACTGTAATGTCTGTAAAGATAATCCCAACAAACTCTGCAAGCATTGTGCTTGTCATAAGTGTGGTGGAAAGGAAAACCCTGGGGACCAGTTGCTTTGTGATGAATGTGATATGGCTTATCATATTTACTGTTTAGTTCCCCCACTAAAAGCAATTCCTGATGACGATGAATGGTATTGCCCACAATGTAAGAATGATACATCAGAGGTGATCCATGCCGGTGAGAAGCTCAGGGAAAGTAAGAAAAAACAAAAGATGGCATCTTCAAATTCAACTGCAAACAGAGATTGGGGCAAGATCACCCCTTATGATGACAATAAGGGTATGGCATGTGTTGGTCGTACCAAAGTCTGCTCTATTGTACCACCAAACCACTTTGGGCCTATTCCTGGTGTTCCTGTGGGCTCAGCTTGGAAGTTCAGGGTCCAGGTCAGTGAGGCAGGAATACACCGCCCACATGTTAGTGGTATCCACGGCAGAGATGGAGAAGGTGCATACTCCATTGTACTGGCTGGTGGATATGAAGATGATTTGGACTATGGAGATGAATTCTTCTACACTGGTAGCGGCGGACGAGATCTCTCAGGAAATAAGAGAACAGCTGAGCAGTCATGTGACCAGACACTAACAAAGATGAACAGAGCACTTGCAAAGAATTGTGGTGCTCCTTTGAATGACAAGGAAGGAGCAGAAGCTAAGAACTGGAAAGAAGGGAAGGCTGTGAGAGTGGTAAGGAGCAGTAAACTAGCCAAGCACTCTGAATTTGCACCCACGGATGGAAATCGATACGATGGTATCTACAAGGTTGTCAAGTACTGGCCGGAGAAAGGCAAATCAGGGTTCATTGTATGGCGTTACCTCCTTCGAAGAGATGACGAGTATCCTGAAGGCTTTTTGGAGGCACAAGCAAAGAAAGAAGAGGAGAAAAAGAAACAAGAAAAAGTGAAAGAGCAAGAAAAGGAATCAGGAAAAGGCAAGGGAAAAGGAAAAGGCAAGAGAAAAAGAAGCGAAGATGAAACCAGTTTAACCACATCACCTCCAGCGAAGAGAAGGAGTTATAAATTGCCAAAGGAAACAAAAACTTTAATTGATGCTGATACCACAAACAAAAAACTATGGAGTGAAGTAACAGCGATACTACAAGATTATCCTAGTTGTCTCCAGCGGTCTTTCAAGGCTCAAGTTTTTTCTTGTCCAGCTTGTCGCGCGGAGCTTGGAAAGGACTATAAACAGACTGTCAATAGCTCATTAGATGCTGCGCTTAATCACTTGTTTCCAGGTTACACCCAGGGTCGGTGACAAGAATTATTCATGTTCGCCGTTGAATCTGTTAGCAACCCGTTTCGAATGTGCTTCATTCGTCATTAACGTTGAAATGAGTGTTTTGGAAACGGCTTTCCGTGGTTAAAAACTTAATTTAAAAAATGACTAATGAGGTTCACGCTCCTTTGTGCGGACGTCACAGAGTGTCTCCTAGGGACTGACCGTAACGTAATGAAGTTCCTGGGCTTAATGCTCAATTAAATGACAGCTTGTGAC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
E7EZF3	E3 ubiquitin-protein ligase UHRF1 OS=Danio rerio OX=7955 GN=uhrf1 PE=1 SV=1
F6UA42	E3 ubiquitin-protein ligase UHRF1 OS=Xenopus tropicalis OX=8364 GN=uhrf1 PE=3 SV=2
B6CHA3	E3 ubiquitin-protein ligase UHRF1 OS=Xenopus laevis OX=8355 GN=uhrf1 PE=2 SV=1

Gene family

Family type	Membership / link
Ubiquitin family	E3\|E3 activity RING\|PHD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12148 all species →	TTD	Tandem tudor domain within UHRF1	Domain	Interproscan
PF00628 all species →	PHD	PHD-finger	Domain	Interproscan
PF02182 all species →	SAD_SRA	SAD/SRA domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003105 all species →	Domain	SRA-YDG	Interproscan
IPR045134 all species →	Family	UHRF1/2-like	Interproscan
IPR019787 all species →	Domain	Zinc finger, PHD-finger	Interproscan
IPR021991 all species →	Domain	UHRF1, tandem tudor domain	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR011011 all species →	Homologous_superfamily	Zinc finger, FYVE/PHD-type	Interproscan
IPR015947 all species →	Homologous_superfamily	PUA-like superfamily	Interproscan
IPR019786 all species →	Conserved_site	Zinc finger, PHD-type, conserved site	Interproscan
IPR001965 all species →	Domain	Zinc finger, PHD-type	Interproscan
IPR036987 all species →	Homologous_superfamily	SRA-YDG superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14140 all species →	E3 UBIQUITIN-PROTEIN LIGASE UHRF-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0010216 all species →	Biological Process	obsolete negative regulation of gene expression via chromosomal DNA cytosine methylation	Interproscan
GO:0016567 all species →	Biological Process	protein ubiquitination	Interproscan
GO:0061630 all species →	Molecular Function	ubiquitin protein ligase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10638	UHRF1, NP95; E3 ubiquitin-protein ligase UHRF1	EC:2.3.2.27	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g10292.t4 across 39 RNA-seq samples of Acropora digitifera. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

39Samples

0TPM > 0

1Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Coral branch	39	0	0.00	0.00

Per sample · hover a bar for the full sample record

Show the sample table (39 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR23047206	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047207	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047208	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047209	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047210	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047211	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047212	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047213	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047214	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047215	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047216	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047217	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047218	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047219	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047220	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047221	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047222	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047223	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047224	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047225	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047226	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047227	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047228	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047229	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047230	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047231	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047232	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047233	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047234	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047235	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047236	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047237	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047238	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047239	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047240	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047241	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047242	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047243	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047244	Coral branch	Coral branch	adult	not recorded	SRP416931

Source: CnidoSite RNA-seq expression matrices (ADIGI_TPM, StringTie quantification over 39 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora digitifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	0	not in this network	-
Negatively correlated	0	not in this network	-

This gene has no edge at all in the Acropora digitifera network, in either direction — it is not one of the genes the network was built from (the network covers genes with enough expression variation across the transcriptome samples). The counts above are a property of the network, not a failed lookup.

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora digitifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region

No called peak overlaps this gene in 1 available assay. Either the gene is not near an accessible or marked region in those samples, or it is not represented in the peak caller’s annotation.

Browse the full epigenomic landscape of this species: DNase-seq (DHS).

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →