Gene detail

Detailed information of g10503.t1 in Acropora digitifera

Genomic Location: chr5Alt:3710396...3724276
NR annotation: XP_044170381.1, acylglycerol kinase, mitochondrial-like isoform X1 [Acropora millepora]
Species Acropora digitifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

chr5Alt.g10503.t1

GTTTTGCTGAAGGGAACCTTTTACTTTACGTGATCGTCAAGAAATCTCGAGTGTTCGCTCTTGTCAAAGCGAGCTCGTTTTACCGGCTTTCATACAGCACAAAGTTTCGACTGTCTAAGAATGCGGAGGAGTGGGACTTTTTTTTTATATCGGACGGCCTGGGGAAGAGCTTCAAAATCCAACATGGCGGACGAGAAGCCGTGGTTTTACACTTTACGAAAACACCGAAAAAAGTCTATTGCAGCGGCAGTATTTGCCGGCTGGTTGATGACTTATGGAGCTAACAAGTACAGAGAGTACATCATAAGAAGAGAATTGTGCCATGAGGCCAAGGCCTTTGGTGATACAACCTTGCCATCTCTTAAAAAGCCAAGAAGACTAACTATGTTTTTTAACCCAGCTGCTGGAAGTGGAAGTGCTGATTCTCTTTTAAAGAAAAATGCTGAACCAATTCTTCATATAGCAGGCCTAGATGTTACCATTGTTAAGACAGATTATGAAGGGCAAATTAAAACACTAACTCAGTACATTGATCCAAAAACAGATGGAATCATTGTAGCTGGAGGAGATGGCTCACTGCTAGAGGTTGTGACTGGGTTACTGAGACGAAGTGACCAGGAAGAAATTAGCAAGATTCCAATAGGAGTGATCCCTCTTGGAAGTCATAATTCCTTCTATAACAGACTTTTTGGCAGAAAGAGTGTTGGGGAAGTGAGAACAATTGGAACTGCGGCATTAGCCATTGTGAAAGGATTTATCAAACCAGTGGATGTCATGGAAATTAAGGGTGATGAAGGTCGGTCAACGTTTGCTCTCTCAAACCTTCACTGGGGTGCGTTCAGAGATGCTAATGAAAAGGAAGATAAATATTGGATAGTGGGACCTTTGAGACGAAAATTGGCATATCTTGTGGCTGCGATGAAGGAATGGCCTCCACTTGTTAACACCATCCTTACTTACCCATTGAACCAATCAGAGTTGAAAGCACAAGAAGACACAATGTCCATCATACAAGAAGGAACAAAATCTCGTGTCTTAGCAACAGCTTGCTGTGAAAGTACAATGCACTCACAACAGAGACATTTCGATAGTGAAGAAAATGAAGTTAGAAAAAACGGATGGATCACCAGTTCAGTGCAAACATTTGGCTTGAGGATATTACCTTTTAGGAAATTAGGCTCGCAGACTGACTGCTTTTTGGAGGTGAAACTGTGGCCTTCAGATCTCACAAAAACTGAGTTCATTGAAACAGGATGGAAAATGGAAAAGGTTGAAAAACAAGGAAAGCAAAACCAAGATGAAGACACAAGGCATCAGTGTTTAACAGTCAAACAGCTGAGGCTGGAGCCAACAGATGACAAGGTCTCATGGTTTTCAATTGATGGTGAACCATTCGAAGCTAAAACAATCACAATAAGCCTTCTTCCCCAAAAACTTCACTTTTTCTTTACCCCAGAAAATGTTTTGTGACAGGTGATCAAGTACAAGGGATTTAAATTGACATACTTTGTCACTATTCCTAAGAGAACTAATCCTACTGCTCTTCCAAATCCCTCTTTTTATTGATCCCTGTGACCTGTACCTTGTTGACGTTATTGGGGTTTGGGTTGTATCATCCATTGTTTTGTTCTCCATCACAGATCTGGAAAGGTATAGGGTCTGTCTCATACAAGCCAAGTTATCACTTAATAATAATTTATTATTATCAAAACTTATGTTCAACAATAAAAAGATTGTGTCCTTCTCACTAAACATTTAAACCGAAAAAACAACATGGCTGTGAAGTTGTACCCATGTCAATGTTTTCCCTGCAGAAGCTAAAGTCTGTACAAGTCTTGTATGGTCCATAGGGTGGAATTGTTGCAAGAACATTAAACAACATATTAGGCATTAAGGGACCGGTGAATTTAGCCTAAATTATTTTTTTTACACATGATGAGGATATATGAAATTCACTTATTTGAACAGCAGATTCAAACAGATGTTTTTGTTGTAGTGAATTTTTATTTCCAGATTAACCTTTTTGTGTATGCTAATGTATGGTAATGTACACAAAAACAAAGGAAAACTAAAATTTACCTGGAAAAAAAATTAACTACAACATATATCCACTATCTATGGGCGTATCACAGCACCACTATCACTGAGGTCAGGGTTCACGTTCTGTTCAGACCTTTCTCTGACTTGCAACTACCTAAGTAGCCCTGAAAACTAGAAAAATTCTTTTTTTCTTATAATTCAGCATGGCTTAGTCTTGGTCCCCGTTTCTTTTTTTCCTTTCTTTTCTTCCTGTTTGAAGTATCTTTATGTTCATTGTCTTCTTCCTTTTGTGATACCTGACATAAAACAAAAAGTCTTGTGACACAAGGTGACTTGAATCTCATTATGCAGTATTGCACATCCATGTAAATTCAAATAATTGTTCTCTGGAGTTGCTTTGACAACAGTAAATACTCCTGATTATGAAAAACATATTGAAAAGCTGATTTTTTTTTTGCTCTTCATAATATGAACCCTCATTTTAATCCCATGTTTCATGCACTTAATTAGGAAAAAGTCTTGGGTGGATCTTTATCATTGCCAATAAAATTATAATATTCAT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q53H12	Acylglycerol kinase, mitochondrial OS=Homo sapiens OX=9606 GN=AGK PE=1 SV=2
Q5RED7	Acylglycerol kinase, mitochondrial OS=Pongo abelii OX=9601 GN=AGK PE=2 SV=1
Q9ESW4	Acylglycerol kinase, mitochondrial OS=Mus musculus OX=10090 GN=Agk PE=1 SV=1

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00781 all species →	DAGK_cat	Diacylglycerol kinase catalytic domain	Family	Interproscan
PF19712 all species →	AGK_C	Acylglycerol kinase C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001206 all species →	Domain	Diacylglycerol kinase, catalytic domain	Interproscan
IPR017438 all species →	Homologous_superfamily	Inorganic polyphosphate/ATP-NAD kinase, N-terminal	Interproscan
IPR016064 all species →	Homologous_superfamily	NAD kinase/diacylglycerol kinase-like domain superfamily	Interproscan
IPR050187 all species →	Family	Lipid Phosphate Formation and Regulation	Interproscan
IPR045579 all species →	Domain	Acylglycerol kinase, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12358 all species →	SPHINGOSINE KINASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016301 all species →	Molecular Function	kinase activity	Interproscan
GO:0001727 all species →	Molecular Function	lipid kinase activity	Interproscan
GO:0001729 all species →	Molecular Function	ceramide kinase activity	Interproscan
GO:0004143 all species →	Molecular Function	ATP-dependent diacylglycerol kinase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0006665 all species →	Biological Process	sphingolipid metabolic process	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016310 all species →	Biological Process	phosphorylation	Interproscan
GO:0017050 all species →	Molecular Function	D-erythro-sphingosine kinase activity	Interproscan
GO:0043231 all species →	Cellular Component	intracellular membrane-bounded organelle	Interproscan
GO:0046512 all species →	Biological Process	sphingosine biosynthetic process	Interproscan
GO:0046513 all species →	Biological Process	ceramide biosynthetic process	Interproscan
GO:0047620 all species →	Molecular Function	acylglycerol kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09881	AGK; acylglycerol kinase	EC:2.7.1.94	Glycerolipid metabolism	ko00561	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g10503.t1 across 39 RNA-seq samples of Acropora digitifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

39Samples

39TPM > 0

1Conditions

30.2Max TPM

15.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Coral branch	39	39	15.27	30.23

Per sample · hover a bar for the full sample record

Show the sample table (39 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR23047207	Coral branch	Coral branch	adult	not recorded	SRP416931	30.23
SRR23047220	Coral branch	Coral branch	adult	not recorded	SRP416931	26.72
SRR23047221	Coral branch	Coral branch	adult	not recorded	SRP416931	26.70
SRR23047235	Coral branch	Coral branch	adult	not recorded	SRP416931	26.13
SRR23047218	Coral branch	Coral branch	adult	not recorded	SRP416931	26.12
SRR23047243	Coral branch	Coral branch	adult	not recorded	SRP416931	25.44
SRR23047236	Coral branch	Coral branch	adult	not recorded	SRP416931	22.46
SRR23047226	Coral branch	Coral branch	adult	not recorded	SRP416931	22.45
SRR23047229	Coral branch	Coral branch	adult	not recorded	SRP416931	18.37
SRR23047242	Coral branch	Coral branch	adult	not recorded	SRP416931	18.37
SRR23047223	Coral branch	Coral branch	adult	not recorded	SRP416931	17.24
SRR23047239	Coral branch	Coral branch	adult	not recorded	SRP416931	17.14
SRR23047244	Coral branch	Coral branch	adult	not recorded	SRP416931	16.70
SRR23047213	Coral branch	Coral branch	adult	not recorded	SRP416931	16.64
SRR23047216	Coral branch	Coral branch	adult	not recorded	SRP416931	16.58
SRR23047211	Coral branch	Coral branch	adult	not recorded	SRP416931	16.16
SRR23047209	Coral branch	Coral branch	adult	not recorded	SRP416931	15.95
SRR23047233	Coral branch	Coral branch	adult	not recorded	SRP416931	15.30
SRR23047227	Coral branch	Coral branch	adult	not recorded	SRP416931	13.38
SRR23047217	Coral branch	Coral branch	adult	not recorded	SRP416931	12.89
SRR23047234	Coral branch	Coral branch	adult	not recorded	SRP416931	11.87
SRR23047224	Coral branch	Coral branch	adult	not recorded	SRP416931	11.68
SRR23047212	Coral branch	Coral branch	adult	not recorded	SRP416931	11.56
SRR23047231	Coral branch	Coral branch	adult	not recorded	SRP416931	11.41
SRR23047230	Coral branch	Coral branch	adult	not recorded	SRP416931	11.37
SRR23047240	Coral branch	Coral branch	adult	not recorded	SRP416931	11.27
SRR23047232	Coral branch	Coral branch	adult	not recorded	SRP416931	11.05
SRR23047215	Coral branch	Coral branch	adult	not recorded	SRP416931	10.64
SRR23047228	Coral branch	Coral branch	adult	not recorded	SRP416931	10.61
SRR23047222	Coral branch	Coral branch	adult	not recorded	SRP416931	10.59
SRR23047241	Coral branch	Coral branch	adult	not recorded	SRP416931	10.54
SRR23047206	Coral branch	Coral branch	adult	not recorded	SRP416931	10.33
SRR23047238	Coral branch	Coral branch	adult	not recorded	SRP416931	10.31
SRR23047225	Coral branch	Coral branch	adult	not recorded	SRP416931	9.90
SRR23047214	Coral branch	Coral branch	adult	not recorded	SRP416931	9.60
SRR23047237	Coral branch	Coral branch	adult	not recorded	SRP416931	9.22
SRR23047219	Coral branch	Coral branch	adult	not recorded	SRP416931	8.70
SRR23047210	Coral branch	Coral branch	adult	not recorded	SRP416931	7.64
SRR23047208	Coral branch	Coral branch	adult	not recorded	SRP416931	6.39

Source: CnidoSite RNA-seq expression matrices (ADIGI_TPM, StringTie quantification over 39 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora digitifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	10	g29178.t1	0.801812864980666
Negatively correlated	62	g12708.t1	-0.799451107361245

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora digitifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region

No called peak overlaps this gene in 1 available assay. Either the gene is not near an accessible or marked region in those samples, or it is not represented in the peak caller’s annotation.

Browse the full epigenomic landscape of this species: DNase-seq (DHS).

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →