Gene detail

Detailed information of g14500.t1 in Montipora capitata

Genomic Location: Sc0000534:169371...206999
NR annotation: XP_029184449.2, probable phospholipid-transporting ATPase IIA isoform X2 [Acropora millepora]
Species Montipora capitata · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

g14500.t1

atgggtcgtattgagatgaaaccaagaacagttgtgttaggaagagagtcagccactcagaagtttcctcgaaatgttatttgtaatcagaaatataacatcataacctttattcctttgactctgtataaccagtttaagttctttctaaacatgtacttccttatcgttgcatcatctcagtttattccagaactgagaattggatatctttacacttactggggacccttggcttttgttgtgtttgttacaatgtgccgagaggcttatgatgactttatcaggttcagaagagacagagaggttaattcacagcaataccagaaactaaccaaaaaaggtgttgtcaatgtgccaagctcagcaattaaagtttcagaccttgtcattgttgaaaaggatcagagagttccagcagatatggtattccttaggacatctgaaaagaatggtgcttgctttctcagaacagatcagatggatggtgaaaccgactggaaactacgtttgactgtagcaccatgtcagaggctcccctgtgatgctgatatgctgaatatcagtgcatctgtctatgcggagaagcctcaaacagacattcatagttttgttggcacatttacacggtatgatggagaaaggaccgaaataccacttagcattgagaacacaatgtgggcaaacacagtgatagcctcaggcacagcagtcggtgtggtgatatacacaggttcagagacacgaagtgttatgaacacctcaaaccccgagacaaagtttgggttaaccgatttggaggtcaacaacctgacaaaagtgctgtttttagccactatgagcctctcgttcgtcatggtatcaattaagggttttaatgggccgtggtatcgctacttctttcgcttcgtccttttgttttcctacatcattccactgagtctcagagtaagcctggatttgggcaaagtggtgtattcatggatgataatacacgacaaagccattcccggtacagtggttttcaagcgtttgcatctgggaactgtttcgtttgggacagactctatggaagaggttgtcgcccacgttaagtcctcgtataatccaagcacaggtttgacgtccaagaagcctggacaggctggatcaaaggttcgtcgtactgttgtcacacgagtgcatgaagccgtcaaagcacttgcgttatgtcataatgtcacgccagtcactgacgatacggaaaaccaatcaacccgattacgcgttgatagcgtgacaagtgaggaaagcgacggagacggtttggaagcaggaaaaatggtgaactatcaagcttctagtccagacgaggttgccttggtaacgtggactgaaagcgtgggattgactttggttcatagagatctatcgagcatgcgtctacggaccccttatggtcaaagtcttgttttcaacatcttacagatttttccattcacttccgaaagcaagagaatgggcatcattgtcagggacatgtcatcaggagaaataacgttttatatgaagggtgcagacactattatgagcagtattgtgcaatacaacgattggctagaggaagagtgtggaaacatggctcgtgaaggcctcagaacactcgttgtggccaagaaagtcctgacggaagatcagtatcaggattttgagcatcggtacaaccaggccaaactgaatatttcagaccgagcaactaaggtaatgggtgtacagaggaccttggagcacgacttagaactgctttgtttaactggtgtggaagataaactccagatcgacgtgcgacctaccttagaaatgcttcgaaacgctggaataaagatatggatgttaacaggtgataagcttgagacggcaacctgcatcgcgcaaagttcgcgccttgttgccaggaaccaaatgattcacacctttaagcagataagtaatcgctcagaggctcatcttgagctcaactccctcagacgaaaaaatgactgcgcgctcatcatcaaaggagaatctttagatgtttgtctacgccattatgagcatgaatttgtggagttggcttgtaactgtcctgtcgttgtgtgctgccgctgttccccgcagcagaaagcagatattgtcaaccttctcaaaaagcacacagggaagaggacttgcgcaattggtgatggtggaaatgatgtcagcatgattcaagcagccgacgcgggagtgggtatagaaggaaaagaaggtcgccaggcgtcgcttgcagcggatttctctatcaaacaatttagatatttgggaagacttttgatgtggcatggcagaaacagttacaagcgatcagctgctctgagtcagtttgtaattcatagaggactaattatctccgtgatgcaagcagtattttcctgtgttttctacttcgcatcagtttcactttttccaggctttcttatgattgggtacggcacgttttatactatgttcccagtttcttctcttgtgttggacgaggatgttccttctgatatcgctttgatttatcctgaactttacaaagatttgggaaagggcaggtcgctgtcgtacaagacgttctttatctgggttcttatcagtatttaccaaggtggtatcataatgtttggagggcttcttctgttcgatcaggatttcattcacgtggtatccataaccttcacggctttgatcctgactgaactgatcatggtggcatttaccattcgcacgtggcattggctcatgctatttgctgaagttattagtcttgcgctgtacgttggaacacttgcagtgctgaagaattattttgatcagaagttccttgtgtcagcagagtttgcatggaaggtggttgttattactttggtcagctgtttgccgctgtacattcttaaatatttgaggcgcaagtacgccccacccagctattcaaaattaacgaattag

Transcript

g14500.t1

ATGGGTCGTATTGAGATGAAACCAAGAACAGTTGTGTTAGGAAGAGAGtcaGCCACTCAGAAGTTTCCTCGAAATGTTATTTGTAATCAGAAATATAACATCATAACCTTTATTCCTTTGACTCTGTATAACCAGTTTAAGTTCTTTCTAAACATGTACTTCCTTATCGTTGCATCATCTCAGTTTATTCCAGAACTGAGAATTGGATATCTTTACACTTACTGGGGACCCTTGGCTTTTGTTGTGTTTGTTACAATGTGCCGAGAGGCTTATGATGACTTTATCAGGTTCAGAAGAGACAGAGAGGTTAATTCACAGCAATACCAGAAACTAACCAAAAAAGGTGTTGTCAATGTGCCAAGCTCAGCAATTAAAGTTTCAGACCTTGTCATTGTTGAAAAGGATCAGAGAGTTCCAGCAGATATGGTATTCCTTAGGACATCTGAAAAGAATGGTGCTTGCTTTCTCAGAACAGATCAGATGGATGGTGAAACCGACTGGAAACTACGTTTGACTGTAGCACCATGTCAGAGGCTCCCCTGTGATGCTGATATGCTGAATATCAGTGCATCTGTCTATGCGGAGAAGCCTCAAACAGACATTCATAGTTTTGTTGGCACATTTACACGGTATGATGGAGAAAGGACCGAAATACCACTTAGCATTGAGAACACAATGTGGGCAAACACAGTGATAGCCTCAGGCACAGCAGTCGGTGTGGTGATATACACAGGTTCAGAGACACGAAGTGTTATGAACACCTCAAACCCCGAGACAAAGTTTGGGTTAACCGATTTGGAGGTCAACAACCTGACAAAAGTGCTGTTTTTAGCCACTATGAGCCTCTCGTTCGTCATGGTATCAATTAAGGGTTTTAATGGGCCGTGGTATCGCTACTTCTTTCGCTTCGTCCTTTTGTTTTCCTACATCATTCCACTGAGTCTCAGAGTAAGCCTGGATTTGGGCAAAGTGGTGTATTCATGGATGATAATACACGACAAAGCCATTCCCGGTACAGTGGTTTTCAAGCGTTTGCATCTGGGAACTGTTTCGTTTGGGACAGACTCTATGGAAGAGGTTGTCGCCCACGTTAAGTCCTCGTATAATCCAAGCACAGGTTTGACGTCCAAGAAGCCTGGACAGGCTGGATCAAAGGTTCGTCGTACTGTTGTCACACGAGTGCATGAAGCCGTCAAAGCACTTGCGTTATGTCATAATGTCACGCCAGTCACTGACGATACGGAAAACCAATCAACCCGATTACGCGTTGATAGCGTGACAAGTGAGGAAAGCGACGGAGACGGTTTGGAAGCAGGAAAAATGGTGAACTATCAAGCTTCTAGTCCAGACGAGGTTGCCTTGGTAACGTGGACTGAAAGCGTGGGATTGACTTTGGTTCATAGAGATCTATCGAGCATGCGTCTACGGACCCCTTATGGTCAAAGTCTTGTTTTCAACATCTTACAGATTTTTCCATTCACTTCCGAAAGCAAGAGAATGGGCATCATTGTCAGGGACATGTCATcaggagaaataacgttttatATGAAGGGTGCAGACACTATTATGAGCAGTATTGTGCAATACAACGATTGGCTAGAGGAAGAGtGTGGAAACATGGCTCGTGAAGGCCTCAGAACACTCGTTGTGGCCAAGAAAGTCCTGACGGAAGATCAGTATCAGGATTTTGAGCATCGGTACAACCAGGCCAAACTGAATATTTCAGACCGAGCAACTAAGGTAATGGGTGTACAGAGGACCTTGGAGCACGACTTAGAACTGCTTTGTTTAACTGGTGTGGAAGATAAACTCCAGATCGACGTGCGACCTACCTTAGAAATGCTTCGAAACGCTGGAATAAAGaTATGGATGTTAACAGGTGATAAGCTTGAGACGGCAACCTGCATCGCGCAAAGTTCGCGCCTTGTTGCCAGGAACCAAATGATTCACACCTTTAAGCAGATAAGTAATCGCTCAGAGGCTCATCTTGAGCTCAACTCCCTCAGACGAAAAAATGACTGCGCGCTCATCATCAAAGGAGAATCTTTAGATGTTTGTCTACGCCATTATGAGCATGAATTTGTGGAGTTGGCTTGTAACTGTCCTGTCGTTGTGTGCTGCCGCTGTTCCCCGCAGCAGAAAGCAGATATTGTCAACCTTCTCAAAAAGCACACAGGGAAGAGGACTTGCGCAATTGGTGATGGTGGAAATGATGTCAGCATGATTCAAGCAGCCGACGCGGGAGTGGGTATAGAAGGAAAAGAAGGTCGCCAGGCGTCGCTTGCAGCGGATTTCTCTATCAAACAATTTAGATATTTGGGAAGACTTTTGATGTGGCATGGCAGAAACAGTTACAAGCGATCAGCTGCTCTGAGTCAGTTTGTAATTCATAGAGGACTAATTATCTCCGTGATGCAAGCAGTATTTTCCTGTGTTTTCTACTTCGCATCAGTTTCACTTTTTCCAGGCTTTCTTATGATTGGGTACGGCACGTTTTATACTATGTTCCCAGTTTCTTCTCTTGTGTTGGACGAGGATGTTCCTTCTGATATCGCTTTGATTTATCCTGAACTTTACAAAGATTTGGGAAAGGGCAGGTCGCTGTCGTACAAGACGTTCTTTATCTGGGTTCTTATCAGTATTTACCAAGGTGGTATCATAATGTTTGGAGGGCTTCTTCTGTTCGATCAGGATTTCATTCACGTGGTATCCATAACCTTCACGGCTTTGATCCTGACTGAACTGATCATGGTGGCATTTACCATTCGCACGTGGCATTGGCTCATGCTATTTGCTGAAGTTATTAGTCTTGCGCTGTACGTTGGAACACTTGCAGTGCTGAAGAATTATTTTGATCAGAAGTTCCTTGTGTCAGCAGAGTTTGCATGGAAGGTGGTTGTTATTACTTTGGTCAGCTGTTTGCCGCTGTACATTCTTAAATATTTGAGGCGCAAGTACGCCCCACCCAGCTATTCAAAATTAACGAATTAG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F1Q4S1	Probable phospholipid-transporting ATPase IIB OS=Danio rerio OX=7955 GN=atp9b PE=3 SV=1
A1A4J6	Probable phospholipid-transporting ATPase IIB OS=Bos taurus OX=9913 GN=ATP9B PE=2 SV=1
O43861	Probable phospholipid-transporting ATPase IIB OS=Homo sapiens OX=9606 GN=ATP9B PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003813 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16212 all species →	PhoLip_ATPase_C	Phospholipid-translocating P-type ATPase C-terminal	Family	Interproscan
PF00702 all species →	Hydrolase	haloacid dehalogenase-like hydrolase	Domain	Interproscan
PF16209 all species →	PhoLip_ATPase_N	Phospholipid-translocating ATPase N-terminal	Family	Interproscan
PF13246 all species →	Cation_ATPase	Cation transport ATPase (P-type)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032630 all species →	Domain	P-type ATPase, C-terminal	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR023299 all species →	Homologous_superfamily	P-type ATPase, cytoplasmic domain N	Interproscan
IPR008250 all species →	Homologous_superfamily	P-type ATPase, A domain superfamily	Interproscan
IPR001757 all species →	Family	P-type ATPase	Interproscan
IPR032631 all species →	Domain	P-type ATPase, N-terminal	Interproscan
IPR006539 all species →	Family	P-type ATPase, subfamily IV	Interproscan
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24092 all species →	PROBABLE PHOSPHOLIPID-TRANSPORTING ATPASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005768 all species →	Cellular Component	endosome	Interproscan
GO:0005802 all species →	Cellular Component	trans-Golgi network	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006890 all species →	Biological Process	retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum	Interproscan
GO:0006897 all species →	Biological Process	endocytosis	Interproscan
GO:0045332 all species →	Biological Process	phospholipid translocation	Interproscan
GO:0140326 all species →	Molecular Function	ATPase-coupled intramembrane lipid transporter activity	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan
GO:0015914 all species →	Biological Process	phospholipid transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01530	E7.6.2.1; phospholipid-translocating ATPase	EC:7.6.2.1	Enzymes with EC numbers	-	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g14500.t1 across 48 RNA-seq samples of Montipora capitata. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

48Samples

46TPM > 0

3Conditions

34.3Max TPM

12.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
whole organisms · ambient pH treatment	21	20	14.13	34.27
whole organisms · low pH treatment	15	14	10.28	21.38
whole organisms · extra low pH treatment pH treatment	12	12	11.71	26.85

Per sample · hover a bar for the full sample record

Show the sample table (48 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11452232	whole organisms · ambient pH treatment	whole organisms	blastula	ambient pH treatment	SRP254626	34.27
SRR11452234	whole organisms · ambient pH treatment	whole organisms	morula	ambient pH treatment	SRP254626	33.32
SRR11452230	whole organisms · ambient pH treatment	whole organisms	planulae	ambient pH treatment	SRP254626	27.78
SRR11452222	whole organisms · ambient pH treatment	whole organisms	planulae	ambient pH treatment	SRP254626	25.56
SRR11452228	whole organisms · ambient pH treatment	whole organisms	planulae	ambient pH treatment	SRP254626	24.66
SRR11452233	whole organisms · ambient pH treatment	whole organisms	morula	ambient pH treatment	SRP254626	23.90
SRR11452231	whole organisms · ambient pH treatment	whole organisms	blastula	ambient pH treatment	SRP254626	20.78
SRR11452242	whole organisms · ambient pH treatment	whole organisms	gastrula	ambient pH treatment	SRP254626	15.80
SRR11452243	whole organisms · ambient pH treatment	whole organisms	gastrula	ambient pH treatment	SRP254626	14.99
SRR11452237	whole organisms · ambient pH treatment	whole organisms	gastrula	ambient pH treatment	SRP254626	13.53
SRR11452250	whole organisms · ambient pH treatment	whole organisms	prawn chip	ambient pH treatment	SRP254626	13.17
SRR11452252	whole organisms · ambient pH treatment	whole organisms	prawn chip	ambient pH treatment	SRP254626	12.21
SRR11452246	whole organisms · ambient pH treatment	whole organisms	prawn chip	ambient pH treatment	SRP254626	12.12
SRR11452259	whole organisms · ambient pH treatment	whole organisms	cleavage	ambient pH treatment	SRP254626	7.19
SRR11452254	whole organisms · ambient pH treatment	whole organisms	cleavage	ambient pH treatment	SRP254626	5.78
SRR11452260	whole organisms · ambient pH treatment	whole organisms	cleavage	ambient pH treatment	SRP254626	3.55
SRR11452263	whole organisms · ambient pH treatment	whole organisms	egg	ambient pH treatment	SRP254626	2.76
SRR11452262	whole organisms · ambient pH treatment	whole organisms	egg	ambient pH treatment	SRP254626	2.62
SRR11452217	whole organisms · ambient pH treatment	whole organisms	fertilized embryo	ambient pH treatment	SRP254626	1.69
SRR11452251	whole organisms · ambient pH treatment	whole organisms	egg	ambient pH treatment	SRP254626	0.97
SRR11452240	whole organisms · ambient pH treatment	whole organisms	fertilized embryo	ambient pH treatment	SRP254626	0.00
SRR11452223	whole organisms · low pH treatment	whole organisms	planulae	low pH treatment	SRP254626	21.38
SRR11452224	whole organisms · low pH treatment	whole organisms	planulae	low pH treatment	SRP254626	19.65
SRR11452221	whole organisms · low pH treatment	whole organisms	planulae	low pH treatment	SRP254626	18.89
SRR11452236	whole organisms · low pH treatment	whole organisms	gastrula	low pH treatment	SRP254626	14.20
SRR11452241	whole organisms · low pH treatment	whole organisms	gastrula	low pH treatment	SRP254626	13.37
SRR11452245	whole organisms · low pH treatment	whole organisms	prawn chip	low pH treatment	SRP254626	12.57
SRR11452249	whole organisms · low pH treatment	whole organisms	prawn chip	low pH treatment	SRP254626	11.70
SRR11452238	whole organisms · low pH treatment	whole organisms	gastrula	low pH treatment	SRP254626	11.39
SRR11452247	whole organisms · low pH treatment	whole organisms	prawn chip	low pH treatment	SRP254626	10.98
SRR11452258	whole organisms · low pH treatment	whole organisms	cleavage	low pH treatment	SRP254626	8.86
SRR11452255	whole organisms · low pH treatment	whole organisms	cleavage	low pH treatment	SRP254626	5.28
SRR11452253	whole organisms · low pH treatment	whole organisms	cleavage	low pH treatment	SRP254626	3.54
SRR11452216	whole organisms · low pH treatment	whole organisms	fertilized embryo	low pH treatment	SRP254626	1.90
SRR11452218	whole organisms · low pH treatment	whole organisms	fertilized embryo	low pH treatment	SRP254626	0.56
SRR11452229	whole organisms · low pH treatment	whole organisms	fertilized embryo	low pH treatment	SRP254626	0.00
SRR11452225	whole organisms · extra low pH treatment pH treatment	whole organisms	planulae	extra low pH treatment pH treatment	SRP254626	26.85
SRR11452227	whole organisms · extra low pH treatment pH treatment	whole organisms	planulae	extra low pH treatment pH treatment	SRP254626	25.53
SRR11452226	whole organisms · extra low pH treatment pH treatment	whole organisms	planulae	extra low pH treatment pH treatment	SRP254626	21.47
SRR11452239	whole organisms · extra low pH treatment pH treatment	whole organisms	gastrula	extra low pH treatment pH treatment	SRP254626	15.79
SRR11452235	whole organisms · extra low pH treatment pH treatment	whole organisms	gastrula	extra low pH treatment pH treatment	SRP254626	14.25
SRR11452248	whole organisms · extra low pH treatment pH treatment	whole organisms	prawn chip	extra low pH treatment pH treatment	SRP254626	11.10
SRR11452244	whole organisms · extra low pH treatment pH treatment	whole organisms	prawn chip	extra low pH treatment pH treatment	SRP254626	9.70
SRR11452257	whole organisms · extra low pH treatment pH treatment	whole organisms	cleavage	extra low pH treatment pH treatment	SRP254626	4.68
SRR11452256	whole organisms · extra low pH treatment pH treatment	whole organisms	cleavage	extra low pH treatment pH treatment	SRP254626	3.43
SRR11452261	whole organisms · extra low pH treatment pH treatment	whole organisms	fertilized embryo	extra low pH treatment pH treatment	SRP254626	3.18
SRR11452220	whole organisms · extra low pH treatment pH treatment	whole organisms	fertilized embryo	extra low pH treatment pH treatment	SRP254626	2.78
SRR11452219	whole organisms · extra low pH treatment pH treatment	whole organisms	fertilized embryo	extra low pH treatment pH treatment	SRP254626	1.71

Source: CnidoSite RNA-seq expression matrices (MCAPI_TPM, StringTie quantification over 48 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Montipora capitata tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	37	g3592.t1	0.974455376166623
Negatively correlated	17	g3501.t1	-0.944743482018962

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Montipora capitata, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →