Gene detail

Detailed information of g2294.t1 in Tripedalia maipoensis

Genomic Location: scaffold_11:15808741...15848707
NR annotation: no NCBI-NR hit recorded
Species Tripedalia maipoensis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

g2294.t1

ATGAGTAGGAAAGTGGTTAAGTGTCCCTCAGAGGACTTAACTTACAAGAACATTGTGGTCGGACATGTTGCTGATCTTGATTACAATAAAGTAAAATACATTGCAGTATCTTTTGAAGGAAGGGAATATGTATTTGGAATAGAAGCCCACCCAGGAGTAAAACAAGGGGAGATTGGTTTCAATGGCATTCAGAGAAAATGGACTGGAATCCCGCTTCAAACAACTGTGGAAGTGAGGCCCTTTGCCTTTGACAAGAGGAAATCATTGCTCAGCACTGTCACTTTGGAAGCAGATTTTTTCAACAGGAAAAAGCCACAGAAAGACCATTATGATACAGACAAGATGGCAGCTGAATTCTCAGTTTCATTCCAGTCTTTACCTTTTGTAGTTGGCCAGCCGGTTGTATTTTCATTTGAGCAGAAAGCTCTTCTCATGTTAACAGTTAAAACCTTGGAAGTTGCTGATATTCAGTCAGCTCTTGCAGGAGGTGCAAGTAACAAATCTTCAAAGATGGTAAACATGGGAGTCTTAATGGCAAATACTCAAGTAATCTTTGAAAAAGCTGAGGACTCACCACTGAGTTTAACAGGAAAGGCAAAGGGCAAGACAGCCATGCCCTCTATCATTAACCCCGACTGGGATTTCTCCAAGATGGGAATTGGTGGCCTTGATAAGGAATTTTCGGCCATCTTCAGACGAGCATTTGCCTCCAGAGTGTTTCCACCAGAAATCGTCGAACAGTTGGGTATGAAGCACGTGAAAGGAATTTTACTTTTTGGACCTCCAGGGACAGGGAAAACGCTTATGGCGCGACAGATAGGCAAGATGCTAAATGCGCGTGAGCCAAAGCTGGTCAACGGACCCGAAATTCTAAATAAATATGTTGGAGAGTCAGAGGCAAATGTCAGGAAGCTTTTTGCAGAAGCGGAGGCTGAGCAACTAAGGGTTGGAATTAACAGTGGTTTACACATGATTATCTTCGATGAAATTGACGCTATCTGTAAACAGCGTGGGAGTCTGTCAGGAAGCACCGGAGTTCATGATACGGTTGTCAACCAACTTCTTGCCAAGATCGATGGTGTGGAACAGCTGAACAACATCCTAATCATTGGTATGACCAACCGAAAGGATCTGATTGATGAAGCTTTACTGAGGCCTGGCCGTCTAGAAGTACAAATGGAAATTGGACTACCAGATGAGGCTGGAAGACTGCAAATCTTACAAATTCATACTGCCAAGTTGAAAGAACACAATAAACTTGCAAGTGATGTTGACCTGAACGGGTTGGCGTCAGAAACGAAGAACTTCAGCGGTGCAGAATTAGAGGGACTGGTACGAGCTGCTACAACAACAGCCATGAACAAACTCGTAAAGGCGGAGACAAAAGTGAATATCGACCCTTTTGCTGTTGAGAGTTTTAAGGTCACCGCTCCAGACTTCTTATTGGCTCTTGAAAATGACATTCATCCCTCATTTGGGACAAGTAACGAAGATTTGGAGAAATTTATTTCAAATGGTATCATAATGTGGGGTCCACCAGTGCAGCGGGTGATGGATGATGGTCGTCTACTTATCCAGCAAACGCGCTGTGGGGAGCTGATATCACCTGTCAGTGTTTTGTTAGAGGGGTGTGAAGGCAGCGGCAAGACAGCGCTGGCAGCCAATCTCGCCATGACCTCAGATTTTCCGTTTGTCAAAGTTTGCTCCCCTGAAAGCATGATTGGTTTCACTGAAGGTGCCAAGTGTCAAGCCATCAAAAAGGTGTTTGATGATGCGTACAGATCAGAATTAAGCTGCATTGTGGTTGATGATATCGAAAGACTAATAGAATACGTGCCAATCGGACCGAGATTCTCCAATACTGTGCTTCAGGCATTGATGGTATTGCTCAAGAGAAAACTTCCTAAGGGAAAGAAGCTTCTTATCATAGGAACGACATCATGTCGTGATGTATTGGACCAAATGCAGCTTCTCTCTGTGTTCAACACAGTCATCCATGTATCAGCCAGAATGAGTCCTGATCACGTGATGAAAGTGATCGAGAATTTAAACTATTTAGAAGCTGAGGAACTTGACTATTTGAAGGGAGCTATTCATCAAAAATGGAGTGGATCATATTTGATCCTTGGTATTAAAAAGCTCCTTGCTTTTGTTGAAATGGCTGTCCAGACAGGCATAGAGCGTCGAGCGGAGAAGTTACTGGACCTCCTTGAAGAGCAGTGCTTGTATACAAAGTAG

Transcript

g2294.t1

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003119 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF17862 all species →	AAA_lid_3	AAA+ lid domain	Domain	Interproscan
PF00004 all species →	AAA	ATPase family associated with various cellular activities (AAA)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039812 all species →	Family	Vesicle-fusing ATPase	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR009010 all species →	Homologous_superfamily	Aspartate decarboxylase-like domain superfamily	Interproscan
IPR041569 all species →	Domain	AAA ATPase, AAA+ lid domain	Interproscan
IPR003338 all species →	Domain	CDC48, N-terminal subdomain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR003959 all species →	Domain	ATPase, AAA-type, core	Interproscan
IPR003960 all species →	Conserved_site	ATPase, AAA-type, conserved site	Interproscan
IPR029067 all species →	Homologous_superfamily	CDC48 domain 2-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23078 all species →	VESICULAR-FUSION PROTEIN NSF	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005795 all species →	Cellular Component	Golgi stack	Interproscan
GO:0006891 all species →	Biological Process	intra-Golgi vesicle-mediated transport	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0035494 all species →	Biological Process	SNARE complex disassembly	Interproscan
GO:0043001 all species →	Biological Process	Golgi to plasma membrane protein transport	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06027	NSF, SEC18; vesicle-fusing ATPase	EC:3.6.4.6	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Tripedalia maipoensis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Tripedalia maipoensis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →