Gene detail

Detailed information of g274.t1 in Acropora digitifera

Genomic Location: chr1Alt:3964896...3981818
NR annotation: XP_029180248.2, ATP-binding cassette sub-family G member 4-like [Acropora millepora]
Species Acropora digitifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

chr1Alt.g274.t1

AGTAGTGAGTCGGTCTCACATGACTTGCATTGTATTTTTCAACACAGAGAAACAATATACCGGGTAGTTTGTGGTGGGTAAAACCGATGGAAAGTTTTATCTCTGTACGTGCAGAGAACTACAAAACAGCAATCAAATGCTGTGGCGGTGAAGAAACTATTTCTGTCGATAGCAAAGATTCGATGCTCGAAGCTGGCGAGTATGGAGAACGGCTGAGTTTCTGGCAACGACCGCGACAAAAAGTGGATCTGCAATTCATTGATGTTACTTACAGCGTGAAGATAAGCCGTAAAGAGGTCAAGACAATAATCCATGGAGTCTCAGGGGAATTCAAGAGTGGGGAACTTGTGGCCATGCTCGGACCATCAGGAGCTGGTAAATCAACATTAATTAACATACTTGCTGGCTACCGAACAAAAGATGCAGGTGGTCAAGTTTTGGTCAATGGTGTGGAACGCAACTTGCGGCAGTTCCGCAAGATGTCATGTTACATTATGCAAGATGACGTTTTGTTGCCACACCTTACAGTTATGGAATCCATGATGGTCTCAGCTAATTTGCACCTCAGAGAGTGCCTTTCACATGGAGATAAAGAAAGAGTGATCAACGAAATCCTACTCAATCTTGGTCTAACAGAGATTGCCAACACGAGACTGAGTGAAATCTCCGGCGGCCAGAGAAAAAGACTCGCTATCGCTCTTGAACTTGTTAATAACCCACCTGTGATTTTCCTTGACGAGCCAACAAGCGGTTTGGACAGTTCATCTGCTTATCAATGCATCGGCCTCATGCGTACACTTGCTCATGGTGGAAGGACGGTCATTTGCACTATTCATCAACCCAGTGCAAAGCTCTTTGAAATGTTTGACAAGTTGTACATATTATCTGAAGGAAACTGTTTGTTTCATGGCACTGTGGAAAAGCTGGTGCCTTACTTGTCCAGCGAAGGCTTCGACTGCCCCAAGTACCACAATCCTGCTGATTACATAATCGAAGTGGCGTCAGGGGAGTATGGCGAGAATGTGATCCCAAGCTTGGTGAAGGCATGGAAAGCACGCGAGGAGAGCATTGCAAAAAAGAACAGCTTGACAAGTAACACAAGCAGTAATATGGTGGTATCCATGCTGCCAAACTGTAACGTAAAAACGAGCACTGACAGCATTATACACGCCGCTAGTCAAACAACTCAGTTTATGGTGCTGTTGAAACGAGCGGCTCAATCCATCTTCAGGGATCGTGTGTTTACTCATTTGCGGTTTGTCTCAATTGCGTCTGTTGGGATCCTCATCGGACTTCTCTACCATGGCATTGGAAACGATGGGAACAAAGTCTTTAACAACACCGGCTGTCTGTTTTTCTCCCTTCTTTTCCTCATGTTTACATCTCTTATGCCAACTGTTTTAACCTTTCCCATGGAGAAACTTGTTTTTATTCGAGAACATCTGAACAACTGGTACAGCCTCAAGTCTTATTATTTGGCGAAAACAATGGCTGATGTCCCATTCCAGATTTTGTTTCCAGTAATTTACTGTACAATAGTGTACTTCATGACAAATCAGCCCAACGAAGGATTGCGTTACACCCAGTTTCTGTCAATCACAATTCTCACGTGTCTCGTGGCCCAGTCAATTGGCTTGTTGATTGGTACAGTCGCTCCTAGTCTCCCGACTGCAGTGTACGTGGCTCCAGTGACTGGGATCCCTGTGCTTCTATTCAGCGGTTTCTTCGTGAATTTTGACACAATCCCTAAGTACATGCAGTGGTTGTCGTACGTGTCTTACGCGCGGTACAGCTGGGAAGGCACAGTCGTCGCCATATATGGAAATAAGCGAGGACCTCTTGAGTGTAAAGATAAGAGGTGTATTTTCGAAAATAGTAAAGATGTGTTGGACGCTATGGACGTAGAAGAAAATGCACTCTTCTTGGAAGGTGCCAAGATCTATTTTGATGCAGTTGTTCTCGTTCTTTTTTTCATTACACTTCGATTGGCCTCTTATCTCGTGTTGCGTTACAAAGTGAAGTCATATCATTAACACTTCTGGAGAAACCAGACGGTTTCTATGGAATCGTTCAGGAGCTACGATTTATTTATATAGGCTTTTTGATTCACGGTACGACGAGGTGGACGATTAAATTCTGGTTGTGTGG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9H172	ATP-binding cassette sub-family G member 4 OS=Homo sapiens OX=9606 GN=ABCG4 PE=1 SV=2
Q91WA9	ATP-binding cassette subfamily G member 4 OS=Mus musculus OX=10090 GN=Abcg4 PE=1 SV=2
D3ZCM3	ATP-binding cassette subfamily G member 4 OS=Rattus norvegicus OX=10116 GN=Abcg4 PE=2 SV=1

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF19055 all species →	ABC2_membrane_7	ABC-2 type transporter	Family	Interproscan
PF00005 all species →	ABC_tran	ABC transporter	Domain	Interproscan
PF01061 all species →	ABC2_membrane	ABC-2 type transporter	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR050352 all species →	Family	ATP-binding cassette subfamily G transporters	Interproscan
IPR003593 all species →	Domain	AAA+ ATPase domain	Interproscan
IPR043926 all species →	Domain	ABC transporter family G domain	Interproscan
IPR003439 all species →	Domain	ABC transporter-like, ATP-binding domain	Interproscan
IPR017871 all species →	Conserved_site	ABC transporter-like, conserved site	Interproscan
IPR013525 all species →	Domain	ABC-2 type transporter, transmembrane domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR48041 all species →	ABC TRANSPORTER G FAMILY MEMBER 28	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0042626 all species →	Molecular Function	ATPase-coupled transmembrane transporter activity	Interproscan
GO:0055085 all species →	Biological Process	transmembrane transport	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0140359 all species →	Molecular Function	ABC-type transporter activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for g274.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g274.t1 across 39 RNA-seq samples of Acropora digitifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

39Samples

39TPM > 0

1Conditions

107.7Max TPM

78.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Coral branch	39	39	78.60	107.67

Per sample · hover a bar for the full sample record

Show the sample table (39 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR23047209	Coral branch	Coral branch	adult	not recorded	SRP416931	107.67
SRR23047218	Coral branch	Coral branch	adult	not recorded	SRP416931	106.61
SRR23047219	Coral branch	Coral branch	adult	not recorded	SRP416931	103.41
SRR23047224	Coral branch	Coral branch	adult	not recorded	SRP416931	102.65
SRR23047237	Coral branch	Coral branch	adult	not recorded	SRP416931	102.43
SRR23047232	Coral branch	Coral branch	adult	not recorded	SRP416931	99.88
SRR23047235	Coral branch	Coral branch	adult	not recorded	SRP416931	96.68
SRR23047211	Coral branch	Coral branch	adult	not recorded	SRP416931	94.23
SRR23047234	Coral branch	Coral branch	adult	not recorded	SRP416931	93.32
SRR23047214	Coral branch	Coral branch	adult	not recorded	SRP416931	92.48
SRR23047215	Coral branch	Coral branch	adult	not recorded	SRP416931	89.89
SRR23047216	Coral branch	Coral branch	adult	not recorded	SRP416931	88.66
SRR23047240	Coral branch	Coral branch	adult	not recorded	SRP416931	87.97
SRR23047225	Coral branch	Coral branch	adult	not recorded	SRP416931	87.72
SRR23047231	Coral branch	Coral branch	adult	not recorded	SRP416931	87.14
SRR23047238	Coral branch	Coral branch	adult	not recorded	SRP416931	86.24
SRR23047230	Coral branch	Coral branch	adult	not recorded	SRP416931	85.65
SRR23047233	Coral branch	Coral branch	adult	not recorded	SRP416931	82.57
SRR23047223	Coral branch	Coral branch	adult	not recorded	SRP416931	82.21
SRR23047239	Coral branch	Coral branch	adult	not recorded	SRP416931	81.15
SRR23047241	Coral branch	Coral branch	adult	not recorded	SRP416931	80.77
SRR23047217	Coral branch	Coral branch	adult	not recorded	SRP416931	79.52
SRR23047213	Coral branch	Coral branch	adult	not recorded	SRP416931	77.47
SRR23047206	Coral branch	Coral branch	adult	not recorded	SRP416931	76.22
SRR23047212	Coral branch	Coral branch	adult	not recorded	SRP416931	76.19
SRR23047228	Coral branch	Coral branch	adult	not recorded	SRP416931	74.21
SRR23047236	Coral branch	Coral branch	adult	not recorded	SRP416931	73.07
SRR23047229	Coral branch	Coral branch	adult	not recorded	SRP416931	71.22
SRR23047227	Coral branch	Coral branch	adult	not recorded	SRP416931	69.77
SRR23047242	Coral branch	Coral branch	adult	not recorded	SRP416931	69.31
SRR23047226	Coral branch	Coral branch	adult	not recorded	SRP416931	61.17
SRR23047208	Coral branch	Coral branch	adult	not recorded	SRP416931	58.83
SRR23047207	Coral branch	Coral branch	adult	not recorded	SRP416931	54.29
SRR23047210	Coral branch	Coral branch	adult	not recorded	SRP416931	52.16
SRR23047221	Coral branch	Coral branch	adult	not recorded	SRP416931	50.33
SRR23047244	Coral branch	Coral branch	adult	not recorded	SRP416931	50.01
SRR23047222	Coral branch	Coral branch	adult	not recorded	SRP416931	48.30
SRR23047243	Coral branch	Coral branch	adult	not recorded	SRP416931	46.27
SRR23047220	Coral branch	Coral branch	adult	not recorded	SRP416931	37.80

Source: CnidoSite RNA-seq expression matrices (ADIGI_TPM, StringTie quantification over 39 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora digitifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	41	g10113.t1	0.908768639706065
Negatively correlated	63	g28357.t1	-0.908286288143995

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora digitifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region
DNase-seq (DHS)	WholeAnimal	1	Exon 1

Browse the full epigenomic landscape of this species: DNase-seq (DHS).

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →