Gene detail

Detailed information of g403.t1 in Acropora digitifera

Genomic Location: chr1Alt:5600642...5609257
NR annotation: XP_029207797.1, transforming protein p54/c-ets-1-like isoform X2 [Acropora millepora]
Species Acropora digitifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

chr1Alt.g403.t1

CGATGAGACCGTTGCTTGCTTCGATGATCATAAAGAGGAAACTGTCGATCATAGGATACGATCACTTTCCGACCTTTAACCGAGGAAAGGTCGTCCCAACGACATCACACGAGTTTGAAGGACCTGAGAAATCGGCAATTGACGTAGCCATGGATAGCGGCTATTCAAGATTGAGGGGCTTTACAGAAACGAGGCTTTCTAGAAACGAGCCACTGGTTTCCAACCCTTACAATTGTAAGCTGACTTATTTCGTATGGAAACTAGTCCATCAGGCGTCTCAAAATTAAGGCACTCATTCCGTTAAAATCTTCGTTTATCTGCCCTGTGGTCTGATGGAGTATCACAAGGCTACGAAGTGGTACATAAATGTCTGATCAAATTATCGACTCCTTACAACAAACTCTCCTAGTGGCTGAAGAAGCAGGAGTTAAAAGGGGACCCAAATGTGTTCTTCAGGCTGAAAAGTGTCGCAACTTATGAGTTAAAGATGCCTGAACAGTTTCCTCTTGCCCTACAAGTTGAGGCTTTTTACAAGTTGAGTCAAATTTCCCAGTTGAGTATGCTCCATGCCGCAAATCAGCCCACAGTCCCAGAGGCGACTCCAGTACCAGGCTTTGAACGGCAAACATTTCCTATGCATTTAACTAGCCAAGATATTGCATCAGCTTTCGATTTCCCCCAAGGAAGATCCTACATGGATGAGTTAATGTTTTACGGCCCAGATAACGAAACGGTCGAAGAATTGTTCAATGGCGACAAATTCAACGAGGCGCAAGCTATCTCCAATTTCGTGCAAAACGATGGCGAACAGCTTCCGGACTTGTCTGTCTTTGAAGACCTCTCGGACGACATCATGAGCGAGCAGTTCCAATTTGCGTTAAAAGCGCAGACCATAAAAGAAGAGACAAAATCGCCAGCACCGTGCGACTCGTTCCCGGGTTTGGGATACAGTTCTGTTGGAAGTCCTCCTTATAGCCCGTCCATCAGCGAAGCCAGTTCCCAAGACTACAGTACTGATGAAGGCTTCCAAAGTGACTTCGAAGAAATCTTGGATATTATGAGAGCTGCCGATTCACCTCTGCCGCAAGCTGAAAAGGAGGAGAAGAAGCCGCATGTTGTGGTTAAAACAGAATCACATGATGTTACTCCACCCAAACCCAGAAAGAAGCGTGGACCGAAGCCGCCTGTTAAATATCGAGGTGATGGACCAATCCAGCTCTGGCAGTTCCTCTTGGAGCTTATCATCGATCCAAACTGCACAAACCTCATCAAGTGGACACACGATGAGGACTACGAGTTCAAAATCCTTCAACCTTCCACTGTAGCCAAAATGTGGGGAAAGAAGAAGAACAAGCCCACAATGAACTACGAGAAACTCAGCCGTGGCCTGAGGTACTACTATGGCAAGAACGTCATAGAGAAAGTTCATGGCAAACGATACGTGTATCAGTTCATGTGCAACATCCCCAAAATCCTTGGCTACGATCCGATGATGAAGCACGAGGACAGCTGTGAGGAGTCGGTGTGTGGAGAACCTGTCATGTCGCCTGATGTCGAAGATCTTCTCAACCTGCCAGCTGTTGAGGCAGAGAGTTTTGTAGCGGGATCTCTCGACTTCAGTGCGTTATGTTAGTTTTTGAAGTTTTCTTTGTTGATAACCAAAACGTTGTGTTACTTCGGTGACGATTTTGTAGCTTGTATCAAGCGTTTTAATGGCAGTTAGTCATTATTTTCTTGAATCACATTGATTCGCGCAATTTCCAAAACTTTGAAAGCACACTATTTACTAGGTATGGATGTGTTCCTTAGTTGAAGTTTTTTTTTCTGCATACTGTGTATGCTAAGGCTATTCTCAAAAACCAGCTACTAGCGTAATTTTGTCGTTCAAAGAAGTTGGTCTTTAAAAAGGCAGTTTTTGCCCGAAAAACGGTGAAACTAAATATAACATTTTGAATTGAGATATCTATAATACACGTAAGTTTAAGTATTATCCACGTAATCAGTTTTTAAACTTTAATGTTGAAGTACAGAAATATAAAAAGTTGTATACCAAAAGTTGAAGTGATAAGTGTCACTTGCCTCGTGGAAGAAGTATTCCATTTAATAGATTTTGAACCTTTTTTTGATCTCTCACAGTAACTGTGGTGATAGTTAGTAAACAAAACACTGTAATTAATTTTTGCTCTCTTTGAAACAAATAAAAAAATAAGTT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P29773	Protein C-ets-2 (Fragment) OS=Lytechinus variegatus OX=7654 GN=ETS-2 PE=3 SV=1
P18756	Protein c-ets-1-B (Fragment) OS=Xenopus laevis OX=8355 GN=ets1-b PE=2 SV=1
P27577	Protein C-ets-1 OS=Mus musculus OX=10090 GN=Ets1 PE=1 SV=2

Gene family

Family type	Membership / link
Transcription factor family	ETS · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00178 all species →	Ets	Ets-domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR000418 all species →	Domain	Ets domain	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR046328 all species →	Family	ETS family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11849 all species →	ETS	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0030154 all species →	Biological Process	cell differentiation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for g403.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g403.t1 across 39 RNA-seq samples of Acropora digitifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

39Samples

39TPM > 0

1Conditions

1,010.6Max TPM

670.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Coral branch	39	39	670.75	1,010.64

Per sample · hover a bar for the full sample record

Show the sample table (39 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR23047243	Coral branch	Coral branch	adult	not recorded	SRP416931	1,010.64
SRR23047220	Coral branch	Coral branch	adult	not recorded	SRP416931	967.27
SRR23047222	Coral branch	Coral branch	adult	not recorded	SRP416931	953.67
SRR23047242	Coral branch	Coral branch	adult	not recorded	SRP416931	929.96
SRR23047229	Coral branch	Coral branch	adult	not recorded	SRP416931	906.28
SRR23047236	Coral branch	Coral branch	adult	not recorded	SRP416931	874.11
SRR23047210	Coral branch	Coral branch	adult	not recorded	SRP416931	848.44
SRR23047244	Coral branch	Coral branch	adult	not recorded	SRP416931	838.32
SRR23047221	Coral branch	Coral branch	adult	not recorded	SRP416931	812.29
SRR23047226	Coral branch	Coral branch	adult	not recorded	SRP416931	795.17
SRR23047206	Coral branch	Coral branch	adult	not recorded	SRP416931	770.02
SRR23047214	Coral branch	Coral branch	adult	not recorded	SRP416931	767.70
SRR23047233	Coral branch	Coral branch	adult	not recorded	SRP416931	749.50
SRR23047208	Coral branch	Coral branch	adult	not recorded	SRP416931	724.98
SRR23047207	Coral branch	Coral branch	adult	not recorded	SRP416931	709.08
SRR23047234	Coral branch	Coral branch	adult	not recorded	SRP416931	707.55
SRR23047213	Coral branch	Coral branch	adult	not recorded	SRP416931	703.95
SRR23047240	Coral branch	Coral branch	adult	not recorded	SRP416931	676.51
SRR23047238	Coral branch	Coral branch	adult	not recorded	SRP416931	659.18
SRR23047239	Coral branch	Coral branch	adult	not recorded	SRP416931	655.39
SRR23047217	Coral branch	Coral branch	adult	not recorded	SRP416931	641.14
SRR23047211	Coral branch	Coral branch	adult	not recorded	SRP416931	635.51
SRR23047227	Coral branch	Coral branch	adult	not recorded	SRP416931	635.48
SRR23047230	Coral branch	Coral branch	adult	not recorded	SRP416931	632.10
SRR23047241	Coral branch	Coral branch	adult	not recorded	SRP416931	630.87
SRR23047223	Coral branch	Coral branch	adult	not recorded	SRP416931	614.27
SRR23047225	Coral branch	Coral branch	adult	not recorded	SRP416931	586.11
SRR23047231	Coral branch	Coral branch	adult	not recorded	SRP416931	572.20
SRR23047212	Coral branch	Coral branch	adult	not recorded	SRP416931	565.90
SRR23047228	Coral branch	Coral branch	adult	not recorded	SRP416931	544.93
SRR23047216	Coral branch	Coral branch	adult	not recorded	SRP416931	536.90
SRR23047215	Coral branch	Coral branch	adult	not recorded	SRP416931	513.99
SRR23047219	Coral branch	Coral branch	adult	not recorded	SRP416931	509.75
SRR23047224	Coral branch	Coral branch	adult	not recorded	SRP416931	496.38
SRR23047209	Coral branch	Coral branch	adult	not recorded	SRP416931	491.75
SRR23047237	Coral branch	Coral branch	adult	not recorded	SRP416931	385.07
SRR23047232	Coral branch	Coral branch	adult	not recorded	SRP416931	381.57
SRR23047235	Coral branch	Coral branch	adult	not recorded	SRP416931	366.21
SRR23047218	Coral branch	Coral branch	adult	not recorded	SRP416931	359.30

Source: CnidoSite RNA-seq expression matrices (ADIGI_TPM, StringTie quantification over 39 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora digitifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	15	g17789.t1	0.815982959006708
Negatively correlated	88	g2951.t1	-0.844910688105626

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora digitifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region

No called peak overlaps this gene in 1 available assay. Either the gene is not near an accessible or marked region in those samples, or it is not represented in the peak caller’s annotation.

Browse the full epigenomic landscape of this species: DNase-seq (DHS).

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →