Gene detail

Detailed information of g4445.t1 in Acropora digitifera

Genomic Location: chr2Alt:27774755...27778603
NR annotation: XP_029194855.2, heat shock cognate 71 kDa protein-like isoform X1 [Acropora millepora]
Species Acropora digitifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

chr2Alt.g4445.t1

TCTGTACTTCGGAAGATTCGCCATCGCCGTGCAAAGGAGTGACCCCGAGTGAACTATTCCTTTCCTATTTCCTAGCTCACAATGCCTGCCCCAGCCGTAGGAATCGATCTTGGCACTACCTATTCATGTGTTGGCGTTTTCCAGCACGGCAAAGTCGAAATTATCGCAAATGATCAAGGAAACAGAACAACTCCCAGTTATGTTGCCTTCAATGATACGGAGAGACTCATCGGTGATTCAGCAAAAAATCAAGTCGCTCTCAATCCATCAAATACTGTTTTTGATGCGAAGCGTCTCATCGGGCGAAAGTTTGACGAAGAGTCTGTTCAATCAGATATGAAACATTGGCCTTTTAAGGTCGTAAGCGAAGGTGGGAGACCGAAGATTAGGGTGGACCACAAAGGAGAGACAAAATCTTTCTTTGCAGAGGAGATTTCTTCTATGGTTCTTACGAAAATGAAAGAAACTGCCGAGGCTTATCTGGGAGAGAAGGTCACCGACGCTGTTGTCACTGTGCCGGCATATTTCAACGATTCTCAGAGGCAAGCAACCAAAGATGCCGGCATCATTGCTGGACTTAATGTTCTTCGTATTATCAATGAACCCACCGCTGCGGCCATTGCTTATGGATTGGACAAGAAAAAAGGCGGGGAGAGCAATGTGCTCATATTTGACTTGGGTGGTGGTACATTTGACGTTTCTGTTCTCACCATCGATGATGGCATCTTTGAAGTGAAAGCAACAAGAGGAGATACACATCTTGGTGGGGAAGACTTTGACAATCGTATGGTTGACTATTTCAAGAAAGAATTCAAGAAAAAGCACAAAAAAGACATTTCGGACAATAAACGGGCTATGCGCCGCCTGAGAACTGCATGCGAAAGAGCAAAGAGGACCCTGTCTGCGAGTGCCCAGGCCAGCATTGAAATAGACTCCCTTTACGAAGGTATTGACTTCTATGAGCCAATCAGCCGTGCCAAGTTTGAGGAAATCAATGCTGATCTGTTCAGAGGCACCATTGAACCAGTTAATGAGGCAATTAGAGATTCCAAGTTGCAGAAGACAGAAATCCATGAAGTGGTATTAGTTGGAGGCTCTACTCGCATTCCTAAAATTCAGCAATTACTGAAAGAATTCTTCGGCGGTACAAAGGAGCTGAACAAAAGTATCAACCCCGATGAAGCTGTTGCGTATGGTGCTGCAGTACAGGCTGCCATTTTGAAGGGAGATAAAAGCGAAGCTGTCGCAGACCTCCTCCTCTTGGATGTGGCTCCCTTGTCACTCGGTATTGAAACTGCAGGAGGTGTAATGACGTCGCTCATCCAACGCAACACAACAATTCCCACGAAGAAGAGCCAGGTGTTCACCACTTATTCAGACAACCAACCTGCTGTATTGATTCAAGTGTTTGAAGGTGAACGCAGCATGACGAGAGACAACCATCTTCTTGGAAAGTTTGAGCTAACGGGCATCCCTCCCGCGCCACGTGGCGTTCCCCAGATTGAAGTGACCTTTGATATTGATGCCAATGGAATCATGAATGTGTCTGCAACAGACAAAAGTACTGGCAAAGAAAACAAGATTGTCATCACCAATGACAAAGGTCGGTTATCCAAAGAAGACATAGAGAAGATGGTTAAGGATGCGGAGAAGTACAAAGCAGAGGACGACCAGCAACGGGACAAGGTTCAAGCGAAAAACAGCTTAGAAAGCTATGCTTACAACATGAAGTCTACAGTCGAAGATGACAAAGTTAAAGACAAAATTAGCGAGGAAGACAAAACGGCAATTCTTGACAAGTGCAAAGAAGTGATTGAGTGGTTGGAGAAAACGGATGCAGCTGACAAGGAAGAGTATGAAGCGAAACAGAAAGAGCTGGAGAAAGTTTGCAATCCCATCATCACAAAGCTTTATCAGAGTGCTGGAGGTGCCGGAGGAATGCCTGGTGGAATGCCTGGAGGAGGTTTCCCTGGAGCTCAAGCTGGTGGACCACAACCCGGAAGTGGAGAAACTTCTGGACCAACTATTGAGGAAGTTGATTAAGCTGCTTGCGTTCTATACATGCCCCTCTGTTTGATGAACCTTCAGAAGTCAGTTAAGTTTTCGAACTGGTTTGAATTGGTTTACAGGTAGAACCAGAAGTGTTGAGTTTCGAGTGAAAATATATATTTTTTTTACGT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A2Q0Z1	Heat shock cognate 71 kDa protein OS=Equus caballus OX=9796 GN=HSPA8 PE=2 SV=1
P11142	Heat shock cognate 71 kDa protein OS=Homo sapiens OX=9606 GN=HSPA8 PE=1 SV=1
P63017	Heat shock cognate 71 kDa protein OS=Mus musculus OX=10090 GN=Hspa8 PE=1 SV=1

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00012 all species →	HSP70	Hsp70 protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029047 all species →	Homologous_superfamily	Heat shock protein 70kD, peptide-binding domain superfamily	Interproscan
IPR043129 all species →	Homologous_superfamily	ATPase, nucleotide binding domain	Interproscan
IPR013126 all species →	Family	Heat shock protein 70 family	Interproscan
IPR029048 all species →	Homologous_superfamily	Heat shock protein 70kD, C-terminal domain superfamily	Interproscan
IPR018181 all species →	Conserved_site	Heat shock protein 70, conserved site	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR19375 all species →	HEAT SHOCK PROTEIN 70KDA	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0140662 all species →	Molecular Function	ATP-dependent protein folding chaperone	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K03283	HSPA1_6_8; heat shock 70kDa protein 1/6/8	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g4445.t1 across 39 RNA-seq samples of Acropora digitifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

39Samples

39TPM > 0

1Conditions

748.1Max TPM

509.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Coral branch	39	39	509.56	748.10

Per sample · hover a bar for the full sample record

Show the sample table (39 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR23047211	Coral branch	Coral branch	adult	not recorded	SRP416931	748.10
SRR23047236	Coral branch	Coral branch	adult	not recorded	SRP416931	723.91
SRR23047222	Coral branch	Coral branch	adult	not recorded	SRP416931	668.02
SRR23047235	Coral branch	Coral branch	adult	not recorded	SRP416931	659.60
SRR23047237	Coral branch	Coral branch	adult	not recorded	SRP416931	633.84
SRR23047223	Coral branch	Coral branch	adult	not recorded	SRP416931	628.64
SRR23047220	Coral branch	Coral branch	adult	not recorded	SRP416931	617.20
SRR23047225	Coral branch	Coral branch	adult	not recorded	SRP416931	601.60
SRR23047209	Coral branch	Coral branch	adult	not recorded	SRP416931	585.64
SRR23047232	Coral branch	Coral branch	adult	not recorded	SRP416931	574.86
SRR23047219	Coral branch	Coral branch	adult	not recorded	SRP416931	571.51
SRR23047227	Coral branch	Coral branch	adult	not recorded	SRP416931	569.11
SRR23047213	Coral branch	Coral branch	adult	not recorded	SRP416931	568.93
SRR23047228	Coral branch	Coral branch	adult	not recorded	SRP416931	562.06
SRR23047216	Coral branch	Coral branch	adult	not recorded	SRP416931	558.55
SRR23047207	Coral branch	Coral branch	adult	not recorded	SRP416931	547.52
SRR23047218	Coral branch	Coral branch	adult	not recorded	SRP416931	530.12
SRR23047241	Coral branch	Coral branch	adult	not recorded	SRP416931	522.26
SRR23047231	Coral branch	Coral branch	adult	not recorded	SRP416931	511.08
SRR23047224	Coral branch	Coral branch	adult	not recorded	SRP416931	486.48
SRR23047217	Coral branch	Coral branch	adult	not recorded	SRP416931	480.34
SRR23047238	Coral branch	Coral branch	adult	not recorded	SRP416931	479.53
SRR23047215	Coral branch	Coral branch	adult	not recorded	SRP416931	475.76
SRR23047226	Coral branch	Coral branch	adult	not recorded	SRP416931	465.96
SRR23047243	Coral branch	Coral branch	adult	not recorded	SRP416931	460.99
SRR23047229	Coral branch	Coral branch	adult	not recorded	SRP416931	460.35
SRR23047221	Coral branch	Coral branch	adult	not recorded	SRP416931	458.43
SRR23047244	Coral branch	Coral branch	adult	not recorded	SRP416931	448.61
SRR23047212	Coral branch	Coral branch	adult	not recorded	SRP416931	444.63
SRR23047239	Coral branch	Coral branch	adult	not recorded	SRP416931	443.70
SRR23047233	Coral branch	Coral branch	adult	not recorded	SRP416931	423.18
SRR23047214	Coral branch	Coral branch	adult	not recorded	SRP416931	414.32
SRR23047242	Coral branch	Coral branch	adult	not recorded	SRP416931	401.87
SRR23047210	Coral branch	Coral branch	adult	not recorded	SRP416931	382.56
SRR23047208	Coral branch	Coral branch	adult	not recorded	SRP416931	374.69
SRR23047206	Coral branch	Coral branch	adult	not recorded	SRP416931	362.60
SRR23047230	Coral branch	Coral branch	adult	not recorded	SRP416931	355.44
SRR23047234	Coral branch	Coral branch	adult	not recorded	SRP416931	347.19
SRR23047240	Coral branch	Coral branch	adult	not recorded	SRP416931	323.62

Source: CnidoSite RNA-seq expression matrices (ADIGI_TPM, StringTie quantification over 39 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora digitifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	12	g11875.t1	0.878597765397206
Negatively correlated	27	g2728.t1	-0.707920399327722

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora digitifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region

No called peak overlaps this gene in 1 available assay. Either the gene is not near an accessible or marked region in those samples, or it is not represented in the peak caller’s annotation.

Browse the full epigenomic landscape of this species: DNase-seq (DHS).

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →