Gene detail

Detailed information of g7175.t1 in Acropora digitifera

Genomic Location: chr3Alt:27914611...27920436
NR annotation: XP_015770738.1, PREDICTED: fibrillin-1-like [Acropora digitifera]
Species Acropora digitifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

chr3Alt.g7175.t1

TCAAAGCGGCTAATGGTTCCGGGAAGACAGAAGTACAAAAATACATTTAACTGAGATTCCACATCGGTGTAGGATTCTGCGATTTTTCTTATTACGAAAAAAAGACACCACTATGATGACTATAATGAAGGAACCTACAAAGAAAACTCAAATTGACAGACTTTCGATAAATAGGTTACCCAATGCCTTGTACAAGAACGTATCAGCTAACCCCAAGATGTGGCTACTAGCAGGATTCGCTTTGGTGGTTATTGTTGTGGTCTTAATTACTACCTACTATGAGCTGCAGAGTGGATCGGTCCAAGAAAAAGATGAGCTAAACAGCAAGAGAACCATGACCACCACAGTTGACTGCAGGCATAAAACTCTGTGTGATGTCAATGCCGTTTGTAAAGCCATTGACCACAATCAACACACCTGCCAATGTAACGTTGGATATCATGGAAATGGTTCTGTTTGTTACGATCTGAACGAGTGTTTGGGAAGTCATAATTGTGGTGATAATGCACGATGCAAGAATACCATGGGCTCGTTCAATTGCGATTGTCTTCAAGGATTTCAAGGTAATGGAATGACATGCCTTGACGTTGACGAATGCAGCGATAGCGTAGACAACTGCAGTCAGCATGCATACTGCAACAATACACTTGGTGCATACAATTGTACCTGTTTTTCTGGCTTCGAAGGGGATGGAAAAACGTGCAGAGACGTGGACGAATGTAAAGTCATGCTTCATCAATGCAATAAACATGCATTTTGCATAAACAATGAGGGTGCTTACAATTGCAGCTGCCTTAATGGTTACCAAGGAGACGGTTGGAACTGCACGGATGTGAATGAGTGCAAATTGGGAATTCATAACTGCAGTGAGTATGCTGACTGCACAAACAGCTTTGGTTCTCACGAATGCACCTGCTATAAGGGATTTGAAGGAGACGGTTGGGTATGCAACGATGTCAATGAATGCGAACGAGGGATCCACAACTGCAGTGAGCATGCTAACTGCACAAACAGCATCGGATCTTATGGCTGCACTTGCCACAAAGGATTTGAAGGAGACGGCTGGGTTTGCAACGATGTCAATGAATGCAAGCGACGGATTCACAACTGCAGTGTGCACGCTGACTGCACAAATAGCATTGGGTCTTATGGTTGTACATGCCACCAAGGATTTGAAGGAGATGGTTGGGCATGTAGTGATATTGATGAATGCAAAATGAAAGTAGACAATTGCAGCCGACACGCATTCTGCACAAACAATGTTGGCGCATTCAGTTGCGAATGCAAGAAAGGATTTGAAGGCAATGGATGGCTCTGCGATGATGTAAACGAATGTTGGAGAGGCACATACAACTGTGACACTCACGCCAGCTGCCAAAACATTGATGGTTCTTATGTCTGTTCTTGCAGCAGTGGATACGAAGGAGATGGACGCACTTGCATGGATATCAACGAATGTCGAAAGGGGACCCACAGATGCAGTCGAAACTCGCGTTGCAGCAACACCCCAGGATCATACAGCTGTCGGTGTGTCGAAGGATATCGTGGCAACGGAGAATATTGCGATGACATCGACGAATGCAACACATGGAATTCTTGCGGCTGGCATGCATCTTGTTCAAATACAGAGGGCTCTTATAAATGCAGATGTAATCCTGGCTTCCAAGGGAACGGAATTTCATGCTCTGATTATGATGAATGTCAAGCGAGCTATCACAGTTGTCACAAGAATGCCAAATGCGAGAACACGTGGGGTTCTTATTCCTGCTCTTGCAACAAAGGTTACCGAGGAAATGGCAAAGACTGCAAACCGTCTTCAGCAAGCAGTCTTCTACTTGGTAAAGAACACCTTGTCTTGCTGGTGTTAACTTATGCGATTGGACATCTTTTTACTGGATGACTTAAACAGGGATGATGGCAATATCTTTTGAGGTAACCTTGTTGGCAACGTGACGCCATGTTGGAAGAACAACGAGAGGACAGGTCCCTGTTCTATAAAATCGCTCTCGGATT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P10493	Nidogen-1 OS=Mus musculus OX=10090 GN=Nid1 PE=1 SV=2
P14543	Nidogen-1 OS=Homo sapiens OX=9606 GN=NID1 PE=1 SV=3

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12947 all species →	EGF_3	EGF domain	Domain	Interproscan
PF07645 all species →	EGF_CA	Calcium-binding EGF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000152 all species →	PTM	EGF-type aspartate/asparagine hydroxylation site	Interproscan
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR009030 all species →	Homologous_superfamily	Growth factor receptor cysteine-rich domain superfamily	Interproscan
IPR024731 all species →	Domain	EGF domain	Interproscan
IPR018097 all species →	Conserved_site	EGF-like calcium-binding, conserved site	Interproscan
IPR049883 all species →	Domain	NOTCH1 EGF-like calcium-binding domain	Interproscan
IPR001881 all species →	Domain	EGF-like calcium-binding domain	Interproscan
IPR009017 all species →	Homologous_superfamily	Green fluorescent protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24039 all species →	FIBRILLIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for g7175.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g7175.t1 across 39 RNA-seq samples of Acropora digitifera. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

39Samples

39TPM > 0

1Conditions

163.1Max TPM

104.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Coral branch	39	39	104.38	163.06

Per sample · hover a bar for the full sample record

Show the sample table (39 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR23047222	Coral branch	Coral branch	adult	not recorded	SRP416931	163.06
SRR23047225	Coral branch	Coral branch	adult	not recorded	SRP416931	151.44
SRR23047238	Coral branch	Coral branch	adult	not recorded	SRP416931	144.33
SRR23047228	Coral branch	Coral branch	adult	not recorded	SRP416931	143.40
SRR23047231	Coral branch	Coral branch	adult	not recorded	SRP416931	141.97
SRR23047241	Coral branch	Coral branch	adult	not recorded	SRP416931	138.31
SRR23047227	Coral branch	Coral branch	adult	not recorded	SRP416931	135.85
SRR23047242	Coral branch	Coral branch	adult	not recorded	SRP416931	134.60
SRR23047240	Coral branch	Coral branch	adult	not recorded	SRP416931	132.76
SRR23047239	Coral branch	Coral branch	adult	not recorded	SRP416931	131.77
SRR23047230	Coral branch	Coral branch	adult	not recorded	SRP416931	125.61
SRR23047234	Coral branch	Coral branch	adult	not recorded	SRP416931	116.02
SRR23047215	Coral branch	Coral branch	adult	not recorded	SRP416931	115.38
SRR23047236	Coral branch	Coral branch	adult	not recorded	SRP416931	114.46
SRR23047212	Coral branch	Coral branch	adult	not recorded	SRP416931	113.62
SRR23047233	Coral branch	Coral branch	adult	not recorded	SRP416931	110.25
SRR23047229	Coral branch	Coral branch	adult	not recorded	SRP416931	109.89
SRR23047224	Coral branch	Coral branch	adult	not recorded	SRP416931	109.01
SRR23047213	Coral branch	Coral branch	adult	not recorded	SRP416931	108.26
SRR23047206	Coral branch	Coral branch	adult	not recorded	SRP416931	105.11
SRR23047223	Coral branch	Coral branch	adult	not recorded	SRP416931	105.04
SRR23047209	Coral branch	Coral branch	adult	not recorded	SRP416931	104.03
SRR23047221	Coral branch	Coral branch	adult	not recorded	SRP416931	99.42
SRR23047220	Coral branch	Coral branch	adult	not recorded	SRP416931	97.82
SRR23047244	Coral branch	Coral branch	adult	not recorded	SRP416931	94.36
SRR23047214	Coral branch	Coral branch	adult	not recorded	SRP416931	94.10
SRR23047217	Coral branch	Coral branch	adult	not recorded	SRP416931	92.00
SRR23047243	Coral branch	Coral branch	adult	not recorded	SRP416931	91.03
SRR23047216	Coral branch	Coral branch	adult	not recorded	SRP416931	89.73
SRR23047226	Coral branch	Coral branch	adult	not recorded	SRP416931	87.67
SRR23047237	Coral branch	Coral branch	adult	not recorded	SRP416931	76.36
SRR23047207	Coral branch	Coral branch	adult	not recorded	SRP416931	76.07
SRR23047208	Coral branch	Coral branch	adult	not recorded	SRP416931	75.82
SRR23047218	Coral branch	Coral branch	adult	not recorded	SRP416931	72.51
SRR23047211	Coral branch	Coral branch	adult	not recorded	SRP416931	70.10
SRR23047235	Coral branch	Coral branch	adult	not recorded	SRP416931	62.51
SRR23047210	Coral branch	Coral branch	adult	not recorded	SRP416931	60.32
SRR23047232	Coral branch	Coral branch	adult	not recorded	SRP416931	44.62
SRR23047219	Coral branch	Coral branch	adult	not recorded	SRP416931	32.38

Source: CnidoSite RNA-seq expression matrices (ADIGI_TPM, StringTie quantification over 39 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Acropora digitifera tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	9	g17072.t1	0.752560273448435
Negatively correlated	46	g5003.t1	-0.754020722241472

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Acropora digitifera, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

Peak calls overlapping this gene

Assay	Sample	Peaks	Region

No called peak overlaps this gene in 1 available assay. Either the gene is not near an accessible or marked region in those samples, or it is not represented in the peak caller’s annotation.

Browse the full epigenomic landscape of this species: DNase-seq (DHS).

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →