Gene detail

Detailed information of g7741.t2 in Acropora digitifera

Genomic Location: chr4Alt:41106...46277
NR annotation: no NCBI-NR hit recorded
Species Acropora digitifera · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

g7741.t2

TTGTTCTTTGAGAAAAACATCCTTCAGTCTACTACAGCAACTACAGCGACTACGGGTACTACAGCTACTGCAAAAACTACAGCTACTACTGCAACTACCGGTACTACAGCTACTACGGGTACTACAGCTACTATAGAAGTTAGCGCTACTACGGGTACTACAGCTACTACAGCAACTACAACTACTACAAGAACTACAGGTACTACAGCTACTACAGCAACTACAGCTACTACAGCAACTATGGGTACTAGAGCTACTACGGGTACTACAACTACTACGGGTCCTACAGCTACTACGGGTACTACAACAATTACGGGTACTACAGCTACTACAGCAACTACAGCTACTACGGGTACTACAGCTACTACAGCAACTACAGCTACTACGGGTACTACAGAAACTACGGCTACTACAGCTACTACAACAACTACGGGTACTAAAGCAACTACGGGTACTACAGTTACTACATCTACTACAACAACTACGGGTACTACAGCTATTACGGGTACTAGAGCTACTACGGGTACTACAACAACTACGAGTACCGCAGCAACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACAGCGACTACGGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAACAACTACGGGTACTACAACAACTACAGGTACTACATCAACTACGGGTACTACAGCAACTGCGGGTGCTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAAAAACTACGGGTACTACAACAACTACGGGTACTACATCAACTACGGGTACTACAGCAACTACGGGTGCTACAGTACAGCTACTACGGGTACTACAGCGACTACAGCGACTACGGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAACAACTACGGGTACTACAACAACTACGGGTACTACATCAACTACGGGTACTACAGCAACTACGGGTGCTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAAAAACTACGGGTACTACAACAACTACGGGTACTACATCAACTACGGGTACTACAGCAACTACGGGTGCTACAGTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACAGCGACTACGGGTACTACAGCGACTACGGGTACTACAGGAACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAGCTACCACGGCAACTACGGGTACTACAGCTACTACGAGTACTACAGCTACTACAGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACAGCGACTACGGGTACTACAGCGACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGCAACTACGGGTACTACAGCAACTACGAGTACTACAGCTACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACAGCGACTACGGGTACTACAGCGACTACGGTTACTACAGCCACTACAGCGAGTACGGTAACTTTACAGCTGCACAGGGTAATACAGTGACGTCTGCTGCTACTTCTGTGGGAATTTATGCTGGTCATCACCTCCGTGTACTTTCACCATGTACAGGAGAAGGCAGTTGGTGCATTGGAAGGGGAGGAATTTTCCCATCCGGCCCGCTCTCGACAGGCGGAATGGACATTTCCTTCAGTTGTAAAATTCTCAAACACAAACTAAAACACAGACAGTACAAAAATATCATTACAACTTTCTTTTTCAACAAAGATAAAGCGGTAGTCAAAATTGCCACGAGAAGCCTGAAACCAAGAAAAATTTTTTTTAGAAGAATACAATAA

Transcript

chr4Alt.g7741.t2

CATTTCAGAGAAAAAAGATTTTGGAGAACTTAAATGATCAACTAAATGTAACAAAAACAAACAAATTCTAAAGATATTTGTTCTTTGAGAAAAACATCCTTCAGTCTACTACAGCAACTACAGCGACTACGGGTACTACAGCTACTGCAAAAACTACAGCTACTACTGCAACTACCGGTACTACAGCTACTACGGGTACTACAGCTACTATAGAAGTTAGCGCTACTACGGGTACTACAGCTACTACAGCAACTACAACTACTACAAGAACTACAGGTACTACAGCTACTACAGCAACTACAGCTACTACAGCAACTATGGGTACTAGAGCTACTACGGGTACTACAACTACTACGGGTCCTACAGCTACTACGGGTACTACAACAATTACGGGTACTACAGCTACTACAGCAACTACAGCTACTACGGGTACTACAGCTACTACAGCAACTACAGCTACTACGGGTACTACAGAAACTACGGCTACTACAGCTACTACAACAACTACGGGTACTAAAGCAACTACGGGTACTACAGTTACTACATCTACTACAACAACTACGGGTACTACAGCTATTACGGGTACTAGAGCTACTACGGGTACTACAACAACTACGAGTACCGCAGCAACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACAGCGACTACGGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAACAACTACGGGTACTACAACAACTACAGGTACTACATCAACTACGGGTACTACAGCAACTGCGGGTGCTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAAAAACTACGGGTACTACAACAACTACGGGTACTACATCAACTACGGGTACTACAGCAACTACGGGTGCTACAGTACAGCTACTACGGGTACTACAGCGACTACAGCGACTACGGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAACAACTACGGGTACTACAACAACTACGGGTACTACATCAACTACGGGTACTACAGCAACTACGGGTGCTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAAAAACTACGGGTACTACAACAACTACGGGTACTACATCAACTACGGGTACTACAGCAACTACGGGTGCTACAGTACAGCTACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACAGCGACTACGGGTACTACAGCGACTACGGGTACTACAGGAACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAGCTACCACGGCAACTACGGGTACTACAGCTACTACGAGTACTACAGCTACTACAGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACAGCGACTACGGGTACTACAGCGACTACGGGTACTACAGCAACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGCAACTACGGGTACTACAGCAACTACGAGTACTACAGCTACTACGGGTACTACAGCAACTACAGGTACTACAGCTACTACGGGTACTACAGCTACTACGGGTACTACAGCAACTACAGCGACTACGGGTACTACAGCGACTACGGTTACTACAGCCACTACAGCGAGTACGGTAACTTTACAGCTGCACAGGGTAATACAGTGACGTCTGCTGCTACTTCTGTGGGAATTTATGCTGGTCATCACCTCCGTGTACTTTCACCATGTACAGGAGAAGGCAGTTGGTGCATTGGAAGGGGAGGAATTTTCCCATCCGGCCCGCTCTCGACAGGCGGAATGGACATTTCCTTCAGTTGTAAAATTCTCAAACACAAACTAAAACACAGACAGTACAAAAATATCATTACAACTTTCTTTTTCAACAAAGATAAAGCGGTAGTCAAAATTGCCACGAGAAGCCTGAAACCAAGAAAAATTTTTTTTAGAAGAATACAATAATATTATCAATAATAAAATTATTGCAATTTA

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Pfam domain

No Pfam domain signature was detected for g7741.t2. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR050938 all species →	Family	Collagen and Collagen-like Structural Proteins	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR37456 all species →	SI:CH211-266K2.1	Interproscan

Gene Ontology

No Gene Ontology signature was detected for g7741.t2. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for g7741.t2.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of g7741.t2 across 39 RNA-seq samples of Acropora digitifera. This gene has no row in the species' RNA-seq expression matrix, so every value below is shown as zero — the matrix simply does not cover this transcript. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

39Samples

0TPM > 0

1Conditions

0.0Max TPM

0.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM	Mean, relative to max
Coral branch	39	0	0.00	0.00

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study
SRR23047206	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047207	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047208	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047209	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047210	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047211	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047212	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047213	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047214	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047215	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047216	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047217	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047218	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047219	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047220	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047221	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047222	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047223	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047224	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047225	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047226	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047227	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047228	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047229	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047230	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047231	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047232	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047233	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047234	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047235	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047236	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047237	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047238	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047239	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047240	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047241	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047242	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047243	Coral branch	Coral branch	adult	not recorded	SRP416931
SRR23047244	Coral branch	Coral branch	adult	not recorded	SRP416931

Source: CnidoSite RNA-seq expression matrices (ADIGI_TPM, StringTie quantification over 39 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.