Gene detail

Detailed information of g9446.t2 in Tripedalia maipoensis

Genomic Location: scaffold_6:5514324...5567524
NR annotation: no NCBI-NR hit recorded
Species Tripedalia maipoensis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

g9446.t2

ATGATTCATCGCATTTACAGGTCACCACACCACTCTGGGGCATTTCTACTTTCAAAGGTCTTAAGGAAAAAGACATTTTTGGCTATTCGCAGCAGTGTCCTCCTTTCTATCAAACCTATTCAATCAGAATCACTTTCCCTTATCATATCGAGCCGAGGAATCTCCTGCTCGGGTGTAACGTCTCACAGCCGTCAAGATCGAGGGAGCAGGATATCAAATACGATGGGAAGCCTTAAGGAAAATGGCAACGAAGATGCATTAGCCTCTTATAGGCTTGCTGTAAAAGAGCAAGGAGACTTGGTAAGAAAACTGAAGGAGAGTGGAGCACCTAAGCAAGATGTTGAGATTGCTGTCAAAGAACTGAAGGCCAGGAAGAAAATGTTAGAGCAGAAGGAGTTACAGTTGGAGGCTAAGGAGGAACAATTTGACCGAGGAAAACTTGAGGACCTCTTAAAAAGGAGATTCTTTTACACACCAGCATTTGAAATTTATGGAGGTGTTGCTGGGCTGTATGATTTTGGACCAATAGGATGTGCTATGGAAACAAACATAGTAAACCTTTGGCGTTCTCACTTTGTATTGGAAGAACAACTTCTTGAAGTCAGGTGCACACAACTCACCCCTCATCAAGTGCTCAAGGTATCTGGCCATGTTGATCGTTTCTCTGACTACATGGTGAAGGATAAGAAAACTGGTGATTGCTACAGAGCAGACCATCTTTTAGAGGGACATCTTGAAAAATTGATGGCTGTAAAAAATTGTACTGCAGAGCTGAAGAGAGAATACCAAGAAGTGCTTGTTCAGCTAGACAACTATGGAAAAGATGAACTTCAAGAGAAACTCGTAAAGTATGGAGTAAAAGCCCCTGGAACGAACAGTGATATTTCAGAACCTGTACCCTTTAACCTGATGTTTGGAACTTCGATTGGACCAAGTGGATTACTGCCCGGGTACTTGCGACCGGAAACTGCCCAGGGAATATTTTTGAACTTTAAACGGCTTCTTGAATACAACAATGGACGTCTACCGTTTGGAGGCGCTCAAATCGGATGTGGATTTCGAAACGAAATTTCCCCCAGGGCTGGTTTGCTGAGGGTTAGGGAATTCTTGATGGCCGAGATCGAATATTTTGTTGATCCAGAGCACAAGAACAATCCGAAATTCTCTTCGGTATCTCACCTGAAGATGCGGTTGTGGCATCGATCAAAGCAGATGAGTGGTGAATCTCCCGTAATTATGTCTCTTCAAGAAGCTGTTGATCAGGGCATCATTGAGAACACAGCTGTGGCCTACTTTGTGGGCCGTATTTACCTTTTTATGATGAAGATCGGTGTCAATGAGGAAAAAATGCGATTCCGGCAACATCTGGCGAATGAGATGGCACATTACGCCTGTGATTGTTGGGACTGTGAACTCAAAACATCATACGGATGGGTAGAATGCGTCGGGTGTGCGGACCGTGCCTGTTATGACCTTCACAATCATTCCTTAGCCAGTGGAGAAAAGCTGGTTGCCCAGGCTGATTTACCGGCGCCTATATCTGTTGATGTTGTTGAGGTTGTTTTAAACAAGCCAGCGGTTGGGAAGGCGTTTAAGAAAAATGCCAAACAGGTCACTGAACATGTTGCCAAGTTAAGTGAAGCTGAAGTACAGGAGTTGGAACAAAACTTTTCGCAGGAAAGTGATTATAAAATAAAGATCGGAGATGAAGAGTTTGCCGTTTCAAAAGCAATGGTACGGGAAGTGAAACGGTACAAAAAAGACGTCCATGTGCGTGAGGTGGAACCACATGTAATTGAGCCATCTTTTGGAATCGGTAGAATAATGTATGCTGTTTTGGAACATAATTTCCAAATCCGAGAAGGTGACGAGCAAAGAACATGGCTGTCTTTACCACCAGCGGTCGCACCCGTGAAATGCTCTGTGCTACCACTAAGCAAAAACGCGGAATTTCTTCCATTTGTGAGATCATTGTCATCTGCCTTAACAGAACTTGATATCTCCCATAAAGTGGATGACTCGGGAGGATCGATAGGACGCCGATACGCCAGAACTGATGAAATCGCCATTCCTTATGGCATCACAGTTGACTTCGATACGATTAACAAATCGCCACACTCTGCTACTTTGAGGGAAAGAAACTCAACGAAACAGATTCGCACAGATATCAATGCGATACCGAACATCGTGCACGATTTGGTCAGAGGAAGAGTATCATGGGCGGAAACGCAGGAGAAGTATGGTCTGTTTGAAGGGCAAGAAACGACGGGAAAATAG

Transcript

g9446.t2

Protein

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004600 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00587 all species →	tRNA-synt_2b	tRNA synthetase class II core domain (G, H, P, S and T)	Domain	Interproscan
PF03129 all species →	HGTP_anticodon	Anticodon binding domain	Domain	Interproscan
PF00458 all species →	WHEP-TRS	WHEP-TRS domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002315 all species →	Family	Glycyl-tRNA synthetase	Interproscan
IPR002314 all species →	Domain	Aminoacyl-tRNA synthetase, class II (G/ P/ S/T)	Interproscan
IPR000738 all species →	Domain	WHEP-TRS domain	Interproscan
IPR006195 all species →	Domain	Aminoacyl-tRNA synthetase, class II	Interproscan
IPR009068 all species →	Homologous_superfamily	uS15/NS1, RNA-binding domain superfamily	Interproscan
IPR033731 all species →	Domain	Glycyl-tRNA synthetase-like core domain	Interproscan
IPR045864 all species →	Homologous_superfamily	Class II Aminoacyl-tRNA synthetase/Biotinyl protein ligase (BPL) and lipoyl protein ligase (LPL)	Interproscan
IPR004154 all species →	Domain	Anticodon-binding	Interproscan
IPR036621 all species →	Homologous_superfamily	Anticodon-binding domain superfamily	Interproscan
IPR027031 all species →	Family	Glycyl-tRNA synthetase/DNA polymerase subunit gamma-2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10745 all species →	GLYCYL-TRNA SYNTHETASE/DNA POLYMERASE SUBUNIT GAMMA-2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004820 all species →	Molecular Function	glycine-tRNA ligase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006426 all species →	Biological Process	glycyl-tRNA aminoacylation	Interproscan
GO:0004812 all species →	Molecular Function	aminoacyl-tRNA ligase activity	Interproscan
GO:0006418 all species →	Biological Process	tRNA aminoacylation for protein translation	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0070150 all species →	Biological Process	mitochondrial glycyl-tRNA aminoacylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01880	GARS, glyS1; glycyl-tRNA synthetase	EC:6.1.1.14	Mitochondrial biogenesis	ko03029	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Tripedalia maipoensis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Tripedalia maipoensis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →