Gene detail

Detailed information of gene01779.t1 in Actinoscyphia liui

Genomic Location: chr1:28157997...28171820
NR annotation: XP_001638035.3, lysine--tRNA ligase [Nematostella vectensis]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gene01779.t1

TAGCTCTGCATGATGTAATATCAACTAATTTTTAGCTCGAGGGAAATGATATTTAAAGCCGACAAAATGTGTGATTGAAATGCTTCTTCGTCAAGTGGGTTTCAGAAGACTACTCGGAGCAATAAACAGGTTTGACCGGATTTCGACCAATCATCGACCAATATCTGTGACCCACGTGTTGATAGCGAGCTTTTCCAACATGGCGGATGCCGGTAGTGAAGAGAAGCTAAGTAAAAATGAGTTAAAGAGGCGGCTAAAGGCCGAGAAAAAGGCAAAAGAAAAAGAAGAGAAACAAACAGCCCAAAAGACACAAAACCCAGGACCAGCAAAGGAGAAGAAGGACGAATTAGATGAGGAATCCCTTGATCCCAACCAATACTTCAAGATCCGAAGTCAGGCTATAGAGGCCCTTAAGAATTCTGATGAACCACCTTATCCTCACAAGTTCCATGTATCAATGTCGTTGTCACAGTTTATAGAAAAATACCAAAATATGGAAACAGGGCAGTGGTTAGAAGAAACTGTTAGTGTAGCTGGACGAATCCATGCTAAGCGTGCATCAGGCCAAAAACTCATCTTTTATGATTTACGAGGAGAAGGAACAAAGATCCAAGTTATGGCTGATGCTCGAACAGCAAAACAAGATTTTGAGGCCGTCCATGGCAAGATTAGAAGAGGAGATATCATAGGTGTAGAAGGCAAACCAGGAAAAACTAAGAAAGGAGAGCTAAGCATTATGCCTTATAATGTCACACTTCTTGCACCCTGTCTACACATGCTGCCTCATCTTCACTTTGGTCTCAAGGACAAGGAAACAAGATTCAGACAGAGATATCTTGATCTGATCTTGAATGAACAAGTTAGAAACAAGTTCATCACTAGGGCAAGAATTATAAATTATGTCAGAAAGTTTCTAGATGTACTGGGATTTCTAGAGGTTGAAACCCCACTTATGAACATGATCCCTGGAGGAGCGACAGCAAAACCATTCATCACACATCACAACGAATTAAACATGGACTTGTACATGCGAGTGGCTCCTGAACTTTATCACAAGATGCTTGTAGTTGGAGGAATTGACAGAGTCTACGAAATAGGAAGACAGTTTCGAAATGAAGGGATTGACCTCACCCATAACCCAGAGTTTACTACTTGTGAGTTCTATATGGCTTATGCCGACTACAATGACTTAATGGAAATAACAGAGTCTATGATCTCAGGAATGGTCAAGAACATCACTGGCGGGTACATTGTCAAGTTCCACCCTGATGCTGTTGATGCCGACAATCTAGGAAAACCTTACAATGTGGATTTTACTCCTCCATTCAAGAGGATGAGTATGGTCAGTGAGCTGGAAAACGTTCTAAACACCAAGCTACCAGAACCCTCGGCATTTGGGACTGAAGAGGCAAGGAAAATAATTGATGACTTGTGCGTCAAGCATGGTGTTGATTGCTCTTCTCCACGCACCACAGCAAGACTACTAGACAAGCTAGTTGGTGAATTCTTAGAAACCCAGTGTGTGAATCCTACATTCATTACAGATCATCCAGAAATTATGAGTCCGTTGTCCAAGTGGCATCGCAAGGTCAAGGGTTTAACAGAAAGATTTGAGCTGTTTGTATGTTGTAAGGAGATATGTAATGCATACACAGAGTTGAATGACCCCATGGTACAACGTGACAGATTTGAACAACAAGCCAAGGACAAAGCTGCTGGTGATGACGAGGCCATGTTTGTAGATGAAAACTTCTGTACTTCACTAGAGTATGGTTTGCCACCCACTGCTGGCTGGGGTCTAGGCATTGATAGACTGGCTATGTTCCTCACAGACTCTAATAATATCAAGGAAGTGCTGTTCTTCCCTGCCATGAGACCAGAAGAAGGTCAGAAAGCAACAGAAGATGACAAAACCACACAATAACGTTATTCACACGCTGGCAAAATACAAATTGGAAAACATTCATGCTTTGCATGATTCTGAACTGTTATTAAATGAAAATTAGTGCACTTTTGAAGCCTTTGTAAATGTAATGAAGGATATAGAATTATTATTATTATTAAAATCTTCTGCAAAACACCACTAGAATTACTATCAAGAACATCCTTTAGGGTGT

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q15046	Lysine--tRNA ligase OS=Homo sapiens OX=9606 GN=KARS1 PE=1 SV=3
Q99MN1	Lysine--tRNA ligase OS=Mus musculus OX=10090 GN=Kars1 PE=1 SV=1
P37879	Lysine--tRNA ligase OS=Cricetulus griseus OX=10029 GN=KARS1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003540 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00152 all species →	tRNA-synt_2	tRNA synthetases class II (D, K and N)	Domain	Interproscan
PF01336 all species →	tRNA_anti-codon	OB-fold nucleic acid binding domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR045864 all species →	Homologous_superfamily	Class II Aminoacyl-tRNA synthetase/Biotinyl protein ligase (BPL) and lipoyl protein ligase (LPL)	Interproscan
IPR018149 all species →	Domain	Lysyl-tRNA synthetase, class II, C-terminal	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR002313 all species →	Family	Lysine-tRNA ligase, class II	Interproscan
IPR004364 all species →	Domain	Aminoacyl-tRNA synthetase, class II (D/K/N)	Interproscan
IPR004365 all species →	Domain	OB-fold nucleic acid binding domain, AA-tRNA synthetase-type	Interproscan
IPR034762 all species →	Family	Bacterial/eukaryotic lysine-tRNA ligase, class II	Interproscan
IPR044136 all species →	Domain	Lysine-tRNA ligase, class II, N-terminal	Interproscan
IPR006195 all species →	Domain	Aminoacyl-tRNA synthetase, class II	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42918 all species →	LYSYL-TRNA SYNTHETASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0004824 all species →	Molecular Function	lysine-tRNA ligase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006430 all species →	Biological Process	lysyl-tRNA aminoacylation	Interproscan
GO:0004812 all species →	Molecular Function	aminoacyl-tRNA ligase activity	Interproscan
GO:0006418 all species →	Biological Process	tRNA aminoacylation for protein translation	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0000049 all species →	Molecular Function	tRNA binding	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0017101 all species →	Cellular Component	aminoacyl-tRNA synthetase multienzyme complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04567	KARS, lysS; lysyl-tRNA synthetase, class II	EC:6.1.1.6	Transfer RNA biogenesis	ko03016	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →