Gene detail

Detailed information of gene05344.t2 in Actinoscyphia liui

Genomic Location: chr2:21023058...21025314
NR annotation: XP_020915064.1, uncharacterized protein LOC110252581 [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gene05344.t2

ATGAGTTACTTCCACAAACCCCACACCAAGCCCTTAGACCACAGGACCCCATTCCAACTTCTCCACGCACATGTTGACGCCCATCCCAATAAGGAAGCGTTCGTCTTTCGCGATGAAAACATGACTAGAATGTCTCTCACCTTCCAAGAATATGAGATGAAGTCCCGGTTGCTCGCTGCTGCCTTCCTGGAGATAGGTCTGGTTCGAGGTGATAGAGTTCTTGTGATGCTACCAACCAGTATTGAGTTTGTGCACATCCACATGGCTCTCAACAGGATTGGCGCCGTTGCTGTTGTTATTGAAGAAGGTAGCTTTCCTACTGTTCATGGGATCAAGGACTTGACTTGCGTTATTGCTCGTGCTGATTCCAGTACACCTAACCAGGATAAAGTCGTACAGAATATCCAATCAGCTCTCGATGAAAACAAGCTAAAAGCAGCCGTAGTGGTCAGCCCTAATACTGGTCCATTGGATCATGATAAGGTTTACCTCTATGAAAAGCTCTTACAAATGGGTCAGACCAACCCTGAGTCTGATAACGCAGTAAAACGCGCTGAAGCTGCTGTCCAGATGGATGATCCAACGTTTGTTATGTTTACATCGGGAAGCACGTCCATCCCTAAACCAATTCAATACACAAACCATGGGTACATCAACGCAGCACGCGTGGATGCATCGATGATGGCTGTTGACAACGACACGATCTATTTCTCGGATGGGCCCTTCGACTGGATCACGGGGATGTTCTTGGGTATTGGGGTTGTCCTAGCGATGGGCTCAACCTTGGTAGTTTTCCCTCCTAAACTCGCATTTCAAGGGGGAATGGTACCAATTATCATGAAGACCGTTGAAGAGGAAGGTTGTACGCATGCGTTGTTCTTATCATACTTTCTTCACGACATGACGACCTGTCATGAAATCCATGACATGAATCTGAGTAAGCTGAAGACTATGTTAACTGGCGGTCAGCCAACTGCAGTCCCTCTACTGAAGAAAATATTCCAGATGATGCCTGACTTGACGATATTGAATATGTATGGCTCCACCGAGACGAATGCAGTTTCTAAGCAACCGATCACGAAGGATATTGTTGACACATTTGAGTATGGAGTAATGGATCTTGTGGATGGTTTGGAATTAAAGATAGTGGACGAGAGGGAACAGATCGTACCACTTAATACAAAGGGGAGAACTGTGCTTACGTTCAGCCTGGGTCTCATTTTGTAACTGGGACTTGATGCTAATCGATGATAAGCCCACAACAGGTCTTGGAAAGAACGGCTGGCACTTCTCTAATGACGCGGGCTCTCTCGATGAAAATGGCAAGCTCAGGCTTCAAGGCAGAATGGATGACATGATCAAATGCGCCACTGAATCTATCACACCTTATGAGATAGAAGACCTCGTCTTGAGACACCCGACAGTCAAGAAAGTGTGCGTCGTTGGTGTTCCTGATCAGCGGCTGTACGAGAAGATATGTGCGTGTGTCATCCTGAAAGATGGTATCCATAGTAACAAAGATGGGCATGTTGAAAAGGAGCTCCACCATTGGTGTGAAGATAATTGTTGGGTGTCGACCGTGGGGTTACCATGGAAACCACATTACTATGTTTTTATGGATGGTTTTCCACTTACCAGGACTGGTAAGTTGAGTAGGAGATTGGTCCGTGAAATGGCGCTCAAACAACTGGGTCTTTGAACACTAGTACTTTCTTGAATTTTCATATAATTATGCTAATTTCATAGACTTCTATGCCATTTTGGCATTGACTGACTCATACCTAAATACGTACCGTGGTAATTGGAAATAACTAGTTGAATATGTAAACTGCATGCGTCTGATCAACTTTAATTTGATGAGAAATTATGTGATAATTGCATTTCACAATGTCAACATCTCTCTTTAGCTGTAGTCTTCAATTGTGTCAATACACTTTGTGTCAGCTAGATCGCGGTAAGAGTACACTGCAGTAAAGGTAAATGTAAAGACC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q499N5	Medium-chain acyl-CoA ligase ACSF2, mitochondrial OS=Rattus norvegicus OX=10116 GN=Acsf2 PE=2 SV=1
Q8VCW8	Medium-chain acyl-CoA ligase ACSF2, mitochondrial OS=Mus musculus OX=10090 GN=Acsf2 PE=1 SV=1
Q82EL5	Acetyl-coenzyme A synthetase OS=Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680) OX=227882 GN=acsA PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003010 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13193 all species →	AMP-binding_C	AMP-binding enzyme C-terminal domain	Domain	Interproscan
PF00501 all species →	AMP-binding	AMP-binding enzyme	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042099 all species →	Homologous_superfamily	ANL, N-terminal domain	Interproscan
IPR020845 all species →	Conserved_site	AMP-binding, conserved site	Interproscan
IPR025110 all species →	Domain	AMP-binding enzyme, C-terminal domain	Interproscan
IPR045851 all species →	Homologous_superfamily	AMP-binding enzyme, C-terminal domain superfamily	Interproscan
IPR000873 all species →	Domain	AMP-dependent synthetase/ligase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42814 all species →	AMP-BINDING DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

No Gene Ontology signature was recorded for gene05344.t2 in Actinoscyphia liui.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10526	OPCL1; OPC-8:0 CoA ligase 1	EC:6.2.1.-	alpha-Linolenic acid metabolism	ko00592	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →