Gene detail

Detailed information of gene05934.t1 in Actinoscyphia liui

Genomic Location: chr2:28645781...28648168
NR annotation: XP_020911728.1, POU domain, class 4, transcription factor 3 [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gene05934.t1

GTAACTGAGTCTGTCCCACCATGAATCGAGACTCTCTGCTCAACAAGACTCTAAGTCCGCCACTATCCAGGATAGCTATGTCCAATGGAACTTTATCCAATTCATATATCAGTAATACTGGTGGAGGACAGTTTCGGGAACCAAGTTGGATTCCGTCAATTCGTGGCTCGAATGGATCGTTGTCATTCCCGTCAAGATCGACGAACCTGATTCCACCGAGCGTGTTTGATACATTCGATGATTCTCACTTGCTGTCAGTGCAGCAGGATTCTTTGCCCAAATACTCAACTAAGCAATCGAAGCAAAGCTACTCAATCCCGGGTCTCCATGTTACGCACGCACCGGACACCTACGATGCACACGACATTTTGGACCAAATATCTGCGTCTTTGCAGCCTTCATGTTCGGTTGGTGATTCGTTTGATAAACCCTTCGAAACGCCGTCTCCTCTCAGTCTCACGTCAGGACATTCTCTCCACGCCATCCACTCTGCTCTCGGGCCCACTAATGATGACATGAACCCTAGAGAGCTGGAATGGTTTGCAGAAAGGTTCAAGCAGAGAAGAATTAAGCTTGGAGTAACTCAAGCCGACGTAGGCACAGCGCTTGCACACTTGAAAATTCCTGGAGTCGGCTCTTTGAGCCAGTCAACGATTTGTAGGTTTGAATCTCTAACTCTCAGCCATAATAACATGATGGCTTTGAAACCTGTCCTGACAGCGTGGCTAGAGGAGGCCGAGAAAGCCTACAAAACCAAACAGATGAACAGTGCTTTTTTACCCAATTCTGACAAGAAGCGAAAACGTACATCCATTGGGGCAGCGGAGAAGCGCTCTCTGGAGGCTTACTTCGCAATGAATCCGCGCCCTTCGAGCGACAAGATCGCCTCGATAGCAGAAAAACTAGACCTTTCAAAAAATGTCGTACGCGTTTGGTTTTGTAACCAACGGCAGAAGAAAAAAAGGATGAAATTTTCAGTACATTGAATAAATGACAATCAACAATCGAATTACAAGGAATATACCCCAATAATATTGAAAATTTTGTCCTACTACAGAGAAAAATCTCTCTTCAGTCAAGTCAAGTTAGTTTGGCTCAAAATTCTAATTATATAAACTTATTCTCGAGAACGGGGATTATTGTCGTAGAGATGTCAATGTCTATTTGGACTTCACAACTATAGCGAGACCTTCAACTTCACCACAAGAATTATACGAAGTGAGAAAAGCGAAGACGATGGATAAACTGTGATGTAAAAAAATTTACTGTTTACTCTTTCGCCGAATGGAAATGTTGTGAGTAGCTCGCGGCGAACAATTATTTGGCTTCACGAGACTTATTACGAGCCGAGACTGAAGAATTCCGTAACATTCATCATTTCCGTTCCAATACAAGTTTATTTCGCTGTTCTGTGCTGATAAGGAAGCGTTATTATCTTGTCTTTCTTGTTTTCGCAAGAGATTGACACTTATCAGCGAAGAAACTTACAAAAACTGCGGTCCCACACCTGCCCTGAGAAGAATAGCCAATTCTGTGTTTGAATGAACTAGAATTTATTAGACGAGCTATATGTAAATTTGACGAAGTCCTTTTAGAATGAAATCTGTTATATTAAACAATATTGAACTTTAAATTGACGATGGACAGAAAGGTACGAAAATTAGTCGTCGATAAACAGCATATATTAATGAATAGCTTACAAACGGTTTCCCCTTCAAATGATATATCGTAAAATACTGTACAAAGACGAATTGTTGGTGCCGGCGTTTGCCGAAGCCAACTTTATGGCATTTCAATGAAGGTCGTCTTTATTGCAAACACTTTGATCCAAAAGTGTAGATTTTGAAAATAACTCACTATCAAGCTCAAATAACTCTAAGATATATATTTTAAATTTTTATATGTTTAAGGAAACTTTTCTGAGTCTGTGTTAGTGTAAATTACTTGTTCAACACCGTGTCCGGTAGTACATTTTTCTTTCTTTTCAAGCTCAGTTTGAAATTCATCAACTGAACGAGGGCCGAATTCATGTGGCTCTTGTGTAATTGTAGTGGAACCCTTTTTGTCCCTTCAAAACTTTGTAATGAATTATGCTTAAATTGGCCTCAAAGTTTTAATAAAGCTAAGAAACAAGA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q90435	POU domain, class 4, transcription factor 3 OS=Danio rerio OX=7955 GN=pou4f3 PE=2 SV=2
Q91998	Brain-specific homeobox/POU domain protein 3 OS=Gallus gallus OX=9031 GN=BRN3 PE=2 SV=1
Q15319	POU domain, class 4, transcription factor 3 OS=Homo sapiens OX=9606 GN=POU4F3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007016 (this species only) · gene tree & orthology
Transcription factor family	Homeobox · all TF in this species
Transcription factor family	Pou · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00157 all species →	Pou	Pou domain - N-terminal to homeobox domain	Domain	Interproscan
PF00046 all species →	Homeodomain	Homeodomain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013847 all species →	Domain	POU domain	Interproscan
IPR001356 all species →	Domain	Homeobox domain	Interproscan
IPR017970 all species →	Conserved_site	Homeobox, conserved site	Interproscan
IPR000327 all species →	Domain	POU-specific domain	Interproscan
IPR050255 all species →	Family	POU domain transcription factor	Interproscan
IPR010982 all species →	Homologous_superfamily	Lambda repressor-like, DNA-binding domain superfamily	Interproscan
IPR009057 all species →	Homologous_superfamily	Homeobox-like domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11636 all species →	POU DOMAIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K09366	POU4F, BRN3; POU domain transcription factor, class 4	-	Transcription factors	ko03000	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →