Gene detail

Detailed information of gene06103.t1 in Actinoscyphia liui

Genomic Location: chr2:30226546...30236587
NR annotation: XP_020910016.1, guanine nucleotide-binding protein G(i) subunit alpha [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gene06103.t1

GTTCGATCAAGCAGGTCGTAGCAATAACGCCAACCAAGAACACTGTACACATACACAAAAACTATTCTATATGGCGAACTCATGAAAACCATTTCGACGACTGAGGGCTACTTTTGAAACGTCCATCTTGGATTGCCACTAGTGAGTTAGCAGATTCTGATCTTCACAAGTTATCTGTTTCGGTTGAGAACCAAAGGATTGTATTGAACCACCATCGACATGGGCTGTACTTTGAGCGCCGAAGACAAGGCGGCCGTCGAACGAAGTAAAATGATCGACAAAAACCTAAGGGCCGATGGAGAAAGAGCAGCTCGAGAAGTCAAACTCCTATTATTGGGTGCTGGCGAGTCAGGGAAAAGTACAATTGTCAAGCAAATGAAAATTATTCACGAGTCTGGTTACTCAAAAGACGAGTGTGCGCAATATAAACAAGTTGTGTACAGCAATACAATCCAGTCTATGATTGCTATCATTAGAGCTATGGGCACATTAAAGATAGACTTTGGCCACCCTGCTAGAGCGGATGATGCAAGGGAGATGTTTGCGCTAGCAGGTAGCATGGAGGATGTTAAATTCACACAGGAACTGGTGTCTATTATGAGAAGATTATGGTCAGACTCTGGTGTACAGGCGTGTTTTGCCCGATCAAGGGAATACCAATTGAACGACTCGGCATCTTATTACTTAAATGCCTTAGACAGACTTGGCTCACATGATTACATACCGACGGAACAAGATGTACTAAGAACAAGAGTAAAGACAACTGGAATTGTTGAAACTCACTTTACATTCAAAGACCTTCACTTCAAGATGTTTGATGTTGGAGGACAGAGATCAGAAAGGAAGAAATGGATTCACTGCTTTGAGGGTGTGACGGCGATAATCTTTTGTGTCGCTTTAAGTGCATACGACTTGGTACTCGCTGAAGATGAAGAAATGAATCGAATGATGGAGAGCATGAAACTTTTCGACTCTATTTGCAACAACAAGTGGTTCACAGATACGTCCATTATCCTCTTCTTGAACAAAAAAGATTTGTTTGCAGACAAGATCAACAAGTCACCACTGTCCATTTGCTTCCCTGAATACACAGGGTCAAATACATACGAAGAAGCAGCTGCTTATATTCAGATGCAATTTGAAAATCTGAACAAACGAAAAGACACGAAAGAGATCTACACACACTTCACGTGCGCTACCGACACTAATAACATTCAGTTTGTCTTTGACGCTGTCACTGACGTGATCATCAAGAACAACTTGAAAGATTGTGGACTCTTTTAATAACAAAACTGAGATGGAACCCAGCTTACTCAACCAGATGTGGCAGTTTGCAACAGTGTGTATACGAGATGTTGTCTGTACAGTCAAGATATTAAATAAAACTAATAAGCTGTTTTTATATAATACCATAAGATTATCATCCTTTGTTGAGTTTGAGTGCTTCCCAATTTGATTATCAGACATTGGTACTTCATGCATGCATGTCTGCTACTGTTCCATCTAGAACTGCCCATCGTGAGCCTCTAGTGCACAATGATCGCAAATCAACAAGGCACTAGTACTAGATGCAAAACAAACGTGATATAGATTTGAAGATGAGATGTAAAACCTTATTAATATGTAATGACTGTGTCATTTGGTGGTGCCACAATCTCAATCATAGTTTTTATGTGTTTCTAATCATAAGAATAGTCACTTGTAACTCATCATATTGGTGGGTGACCGGGGGAAATCAGTGTACTTGTCAGGGTTGTAATAAACACCGCTGCCATCCCTCCAGTCTCCCCCACTACTATCTCTAACAACATTGACAACCAAGTGAAGTAAATAAGAAGGTGGATGTTGAATGAGTGAGAAAATGAAGATTATTCATTACATTCTATCATTCATTAGTATGAGTACGTGCATGTTGCTTCCAAGAAGATGTCAAGGGATTCTCCACTAATTCAACATCCACTATCCTTCCATCCAAGTTAATATATGTACATTCCTCCTGTCCATCAATCGATGTCTATTTGGTAAGATTGTCCAGTGTCTAAAACATTATTACTGATGTAATTAGTTTAGGCAACAAGACTCAGTACGATTCAGGCTGGCCGGATGATTTTCACATAAAAGAGCATTAAAGTATTATGATTTTAGCTTTACTTGTGTGCTTTACTTGTGTGCTTTACTGGTGTATTTTAGTTATTTTATTACCATCACCAAAGCAATAAACACAACAAATTAACAACAACAAAAGAGGCAGGGCGACCACAACAGCATAGCCATAGTTGAACCTATAGTCTTATTTGTCTTATTGTATGTTATTATGTAGTTTCGATAGTACGCACGCTGTGATTGGTCGAAAGCTGTGC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P38401	Guanine nucleotide-binding protein G(i) subunit alpha-1 OS=Cavia porcellus OX=10141 GN=GNAI1 PE=2 SV=3
P30676	Guanine nucleotide-binding protein G(i) subunit alpha OS=Patiria pectinifera OX=7594 PE=1 SV=3
P63097	Guanine nucleotide-binding protein G(i) subunit alpha-1 OS=Bos taurus OX=9913 GN=GNAI1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000664 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00503 all species →	G-alpha	G-protein alpha subunit	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001019 all species →	Family	Guanine nucleotide binding protein (G-protein), alpha subunit	Interproscan
IPR001408 all species →	Family	G-protein alpha subunit, group I	Interproscan
IPR011025 all species →	Homologous_superfamily	G protein alpha subunit, helical insertion	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10218 all species →	GTP-BINDING PROTEIN ALPHA SUBUNIT	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003924 all species →	Molecular Function	GTPase activity	Interproscan
GO:0007186 all species →	Biological Process	G protein-coupled receptor signaling pathway	Interproscan
GO:0019001 all species →	Molecular Function	guanyl nucleotide binding	Interproscan
GO:0031683 all species →	Molecular Function	G-protein beta/gamma-subunit complex binding	Interproscan
GO:0001664 all species →	Molecular Function	G protein-coupled receptor binding	Interproscan
GO:0005834 all species →	Cellular Component	heterotrimeric G-protein complex	Interproscan
GO:0007188 all species →	Biological Process	adenylate cyclase-modulating G protein-coupled receptor signaling pathway	Interproscan
GO:0005525 all species →	Molecular Function	GTP binding	Interproscan
GO:0007165 all species →	Biological Process	signal transduction	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04630	GNAI; guanine nucleotide-binding protein G(i) subunit alpha	-	GTP-binding proteins	ko04031	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →