Gene detail

Detailed information of gene08519.t1 in Actinoscyphia liui

Genomic Location: chr11:10803970...10829206
NR annotation: XP_020894723.1, condensin-2 complex subunit H2 [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gene08519.t1

AATGTCTTGAGTAAAAATCATGTAAAAATCATCAAAAATACCGCTAAAAACATGCCTACGCCGACGTTCACTGCTTTAGGGAGAGATGGAATCTCCAAATTCAGCGCTATTTTGCAGCCGATTCGTGATATGGCTAAAAACTGGGACATCCAAGTCGCTACAATGTTGGAGGAGTATTTGGCTGATATCGAGAAAATTCAAATTTCATTCGATGGGGGAATGACGACGATGAATTTTGCTGAAGCAGCTTTGCTCATCCAAGGATCAGCATGTGTTTACAGCAAAAAGGTTGAATATCTGTACACATTGGTATATCAAACGTTGGACTTAATTGCAAGTAAAAAACGTCTTCAACAAGCTTCATCGGTAGATGAACAAGGACGAGATAAAGACATTACTACAAGAGCACAAGAAGAAGAGTTTTTATCCCTGGATGACATCCAAGAATGCAAAAATATTGATTTAAAAGAAGATGACGATTTCCCTAAAAGTGAGGGTTCTAGAATAATCCCCAGGACACCGCTTGCATTGATTCCCATGGGGGAGAGGGACAAGAAAGATGTATTGCTAAGCCACACTGGAGAAGTACTAGGAAGCCGGAATGATTTTAAGATGAACACATGTAAAGTCCACGCATCAGGAGCATTACTCCTTGACCTCGGTAACGTTATGTTGGCTGACCACTCCTTCAGAAAGCTGCCGACATCTACTCCTTGCAACTATGCTCTTGAGCAGGGCACTGCTGATGACCTTATAAAAGATGTAAAACCTCTTGACACCATAGAACAACAACCAGAGGTGAATGGTGAGATAGACATGGGCAATGATTACAATGATGATTACAATGATGGTGATGACATGTATGATGATGATGATGGAGCGGCAGTGGAACAGCAAGAAGATATGCAAGAGAAGAGAATGCAGTTGAGAAACCGAGACAGACAACAACAGATGCAGATTCAAAAACAAATGCTTAAAGTACAAGATTATTGGGAGTTGCTTGACCCACACAATCCTGGAAGAATGGCTGACAAGCCTCTAAAGAAAGGTAAACCGTATAAAATTCCACCATCCATACTGGAACCAGGGAAAGACAATAACCGAAAGAAAAGAAAACGAAATGAAAAGAAGGAAAAGAAAGCATACTTGATGCCGCTACATGAATTCTGTACTACAGCCTTTTATTCGCATTCATCAAAATTCCCTAAAAATCCATTGAAAGCACCAGTTTATAAAGAGTTTGAGTACCTTTATTGGGTTGAGTTTAGAAGACGAGAAGAAATAGAAAAGAAACAGAAGAAATTACTGGCTCAGTACCTGACTGAAGAGCAAATAGAGGATCTAGATTCTGTTGTTCCTGAATACAAAGATGAACCTGTAGAACAAGACAACATTCCAGCTTATGCTCCAGAGGATGGCGCAGATTATGATGATGATGATAATAATAATAATTTCAGTGGCACTGATGCTGGTCATGAACCCATTGCTCCAATAGCTCTTGAAGAATCACCAGAGGAGCTAGTGGTATCCAGTTATGAAGACCTTGTGCGGCGATATGTGGAGGGTTATCTCATGGAAGCTCAACACTACGCACAAGAAACAGACCTCAGTAGACGAGTCCATGAATGGGAAGAAAAGATTTTACCAACACTGCATTTAGAGGAAACACACCAACCATATGATATTCATCTGTATGGTTCAGAAATTCTTGGTTCCTTTGAAGACAAGCAGAATGTACCATTTGCTGAGATGATGCAGGGCAAGGAACCATTTGATGTTTGTCGTTATTTCCTAGCAACACTACAGCTGGCTAACAACTACAATGTAGAGATAGGTTCCATTAATCCAGAGTCCAGAGATCCAGATTCCATGTTATTAAAGTTACTACACAAGACTCCAGCCCATGATGCCATTCGAACATACAGAGCACCCTCCATCGTGACGTAGAGCTATGTTGCAGTTAATATAACTAGTTCAAACTGAATTTGTATAGGTAATCATAATTAGCCACTTTACTAACGAGTGGAGGACTGGG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q641G4	Condensin-2 complex subunit H2 OS=Xenopus laevis OX=8355 GN=ncaph2 PE=1 SV=1
Q28GV1	Condensin-2 complex subunit H2 OS=Xenopus tropicalis OX=8364 GN=ncaph2 PE=2 SV=1
Q6IBW4	Condensin-2 complex subunit H2 OS=Homo sapiens OX=9606 GN=NCAPH2 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007462 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16858 all species →	CNDH2_C	Condensin II complex subunit CAP-H2 or CNDH2, C-terminal wHTH domain	Domain	Interproscan
PF16869 all species →	CNDH2_M	Condensin II complex subunit CAP-H2 or CNDH2, mid domain	Family	Interproscan
PF06278 all species →	CNDH2_N	Condensin II complex subunit CAP-H2 or CNDH2, N-terminal	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR031737 all species →	Domain	Condensin-2 complex subunit H2, C-terminal	Interproscan
IPR031739 all species →	Family	Condensin-2 complex subunit H2	Interproscan
IPR031719 all species →	Domain	Condensin II complex subunit H2, middle domain	Interproscan
IPR009378 all species →	Domain	Condensin II complex subunit H2, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14324 all species →	CONDENSIN-2 COMPLEX SUBUNIT H2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000796 all species →	Cellular Component	condensin complex	Interproscan
GO:0003682 all species →	Molecular Function	chromatin binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0010032 all species →	Biological Process	meiotic chromosome condensation	Interproscan
GO:0030261 all species →	Biological Process	chromosome condensation	Interproscan
GO:0051306 all species →	Biological Process	mitotic sister chromatid separation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11490	NCAPH2; condensin-2 complex subunit H2	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →