Gene detail

Detailed information of gene08982.t1 in Actinoscyphia liui

Genomic Location: chr11:18524084...18549676
NR annotation: XP_020903308.1, myelin regulatory factor, partial [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

gene08982.t1

ATGGCTGCCAATAGATTTCTGGAAGGCAACAATGGAGGAACAAATGCTATTTACGCAATGGAACAACCCGACCAAGTACATGTCAATGCTGGCTACGTAAACAACGAGGGACGAGATGTTATGTTCTGTCCAGAGCAAAAATACGATGTGGTAGGACAGTACACAGGAGAACCAATCAACATACCTCGTTCAACTCGTCAAGAACCACTTACCCTCACTCCACCCCGGTCAGTAGGATCTGATTCTCCTATGGACGAACAAGGTCTGTCTGTCCACATCGGTCCAGATAGTACCATCGATGTAGAGAAGTTCTCGAGTCTCTTTGGTAACCATTCGTTGCTTGGCAATGGACTTGAAGAACCAATGACCACTTCGTCTGGTTGCATGATGGCACACACAGTGTGCGAACCAGAACCAAGACGAAAACGACGTAAAACTGAACCAGATGCCATGATATCCGACTGCCCGGTTGGCATGGCAACAATCAAATCTGAACCAGGAAGCTTAACAGACGATGTGTTTATCGATACTGACAGTAGGTCTAGTAGTGTATCCAATGACATGCTTACACCTGATGCAGACGTGACGTCATACCAATGTATAAAGTGGGCTGACTTCAAGAAGGCACAATGGAATGATTTGTATGATGACAGCCAAGACATCATTTCAAAGGTAGATCTCATTGTGGATGCTGACAAAGGCTTCAACTTCTCATTCGCTGACGACTCGTTCGTCTGTCAAAAGAAAAACCATTTCCAAATCACTGTCAATGTGAACACAGAAAGTACTGCTAAGTACATCAAAGTCAAGGACACGTTTAAACCCATCGATAAGTTCAAAATCCATTTGTTTGGCGTCAAGGTCGAGTCAATTAACTCCACTATCAAGGTTGAACAATCACAAGCTGACAGAAGCAAACGGCCATATGAGCCTGCTGTTATGCCTGCCCCAGGGCCAGAAGCATCGCGAATGACAATAGGACGACTACACTTTAGTGAAACAACGTCTAATAATATGAGGAAAAAAGGAAAACCAAATCCTGACCAAAGATACTTCATGCTTGCTGTCGCTCTGCATGCTCACACCAAGAACGAAAACCAACTCATTTATGCTACAGTGTCTGATCGCATCATAGTCAGAGCTTCAAATCCGGGACAATTCGAAAATGATGTGGAAGTAGTATGGTCACGTGGTCACACATCTGACTCAGTGTTCAGAGTGGGTCGAGTAGGCATAAACACAGACAAACCATGTGAATCGTTGTCAGTTCATGGTAATATACGAGTGTCTGGTAGAATACTGGTGCCGTCAGACATAAGAATCAAAGAAAACTTAACTGAGACGAGGTCCAAAATGGCGATGATGTTAAGATCATTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGGTGCTGGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGGTGCTAGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGGTGCTAGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGGTGCTGGTACTCTGTGTGATGTGGATTATGGGCTTACTGATGACAGTGATGGTGCTGGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGGTGCTGGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGGCAGTGATGATGCTGGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGATGCTGGTACTCTGTGTGATGTGGATTATGGGCTTACTGATGACAGTGATGGTGCTGGTACTCTGTGTGATGTGGATTATGGGCTTACTGATGACAGTGATGGTGTTGGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGGTGCTGGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGGCAGTGATGATGCTGGTACTCTGTGTGATGTGGATTGTGGGCTTACTGATGACAGTGATGATGCTGGTACTCTGTGTGATGTGGATTATGGGCTTACTGATGACAGTGATGGTGCCAGTACTCTAGATGACTTACTTGTACGAACAAAGTAA

Transcript

gene08982.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y2G1	Myelin regulatory factor OS=Homo sapiens OX=9606 GN=MYRF PE=1 SV=3
Q3UR85	Myelin regulatory factor OS=Mus musculus OX=10090 GN=Myrf PE=1 SV=2
Q66IV1	Myelin regulatory factor OS=Xenopus laevis OX=8355 GN=myrf PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004809 (this species only) · gene tree & orthology
Transcription factor family	NDT80_PhoG · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05224 all species →	NDT80_PhoG	NDT80 / PhoG like DNA-binding family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR051577 all species →	Family	Myelin Regulatory Factor-like	Interproscan
IPR024061 all species →	Domain	NDT80 DNA-binding domain	Interproscan
IPR008967 all species →	Homologous_superfamily	p53-like transcription factor, DNA-binding domain superfamily	Interproscan
IPR037141 all species →	Homologous_superfamily	NDT80 DNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13029 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003700 all species →	Molecular Function	DNA-binding transcription factor activity	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005789 all species →	Cellular Component	endoplasmic reticulum membrane	Interproscan
GO:0016540 all species →	Biological Process	protein autoprocessing	Interproscan
GO:0043565 all species →	Molecular Function	sequence-specific DNA binding	Interproscan
GO:0045893 all species →	Biological Process	positive regulation of DNA-templated transcription	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for gene08982.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →