Gene detail

Detailed information of gene14979.t1 in Actinoscyphia liui

Genomic Location: chr4:24780640...24802450
NR annotation: XP_020905394.2, ATP-dependent RNA helicase A [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

gene14979.t1

ATGGCGGGCATGGTGAAGAATTTTTTGTATGCCTTTTGCGGCAAGAAAAAGGTCCAGCCAGTTTACTCAGAACGGCCATCAAAGGGTGGGAAGTTTTTCTACCAGGTCCAAGTCAACAGCTTTGATTACATCGGTTTTGGATCAGCAACTAACAAGAAAGATGCTGAAAGTAATGCTGCTAAAGATTTTGTTGGTTTTCTCATTGGCGCTGGATTCATTCCTGCTGATTCTGTTCCTGATGAAATACTGAGTGAACAGAATGGAGGACAGACTGCTGTGACACCTCAGCCATTACCGTCAAATGCAGCCCCGGCACCTCAAGCTATGGTAGCAATACAACCAAACCAACCTAACATGCCACCACAGTCATTGTTTAACCAAGGAGGTGATTTTGGTGCTAGTTCCAGAGATGGTGCCTCATCTAGGGACTATCACTACAGTATGTACAACAAAAGAAGCTTTGCCGAGGCAGAAGATCTTGATGTGGATTCCCATCTCCATGGAAACTGGAGCCTTGTAAATGCAAAGTCTAGACTACACCAATACATACAACAAAACAGACAATCAGCTGATTTTAAATACAATACAGTGGGTCCAGACCATAACAGATCATTTAAGGCAGAGCTTCCTGTTTTCATCAAAACACACAGAAAAACTATCCGTGGCACTGGTACTGCATCTACCAAAAAACAAGCAGCCATTAGTTGTGCTCTAAGTCTGGTCCGTCAGTTATTTCACATTGGTGCTATAGAGGCTGCAGAGCCTGGACAAACACAAGCCAAGAAAATGAAAACAGACGAAATAGAGCCATATGATGTTGGTATCAGTCCTGAGCTGGAGCAGCAATTGACAAACTTACTGGGGGATCTTGGAATTCAGCCTGTACTTCAACCTCAAACCCCAGAAGAAGAAGTCTCCCTAGTTTTACCTCCAGGAAGTAAGTTTGACGTAGAAAAACCAGGTGATATTAGAGGTGTCATTGAATGGACACCACCAGAAATGAACTGGAATCCATGGATCAGCCAACCAATGATCATAGAAGGTGCTGAACAGTACCAGGAGCCAATCCCAACTAGTAAGGATTACCAGGATGAATTCCTTCACAAATGTCAATCTGATCCAACGTTTAAGTCATTACTTGAACAGCGCAGCTCTTTGCCTGTGTACAACTACAAAGATAGTCTATTACAAGCCATCCATGAAAACAGGGTTGTCATCGTCAAGGGGGCCACTGGGTGTGGCAAAACAACACAGGTTCCACAGTTTATTCTGGATGAGTACCTTGCAAATGGGAGAGGTGCTGAATGCACCATAGCTGTCACACAGCCTCGTAGAATCAGTGCTGTCAGCGTGGCTGAGCGTGTAGCAGTAGAGCGAAATGAACCCATTGGCACTAGTATTGGTTACTCTGTGAGGTTTGACTCTATTCTTCCTCGTAGTCATGCCTCCATTTTCTTTTGTACTGTTGGTGTTTTATTGAGAAAGCTTGAGAATGGACTTCATGGAGTATCACATGTTGTTGTTGATGAGATTCATGAACGAGACATCAATACTGACTTCATCCTTGTGGTGTTACAACGGATGCTCCAAACCTACCCAGACCTGCGCGTTGTACTCATGTCTGCTACCATAGATACACAAATGTTTGCAGACTATTTTGGTAACTGTCCTATTATTGAGATTGAGGGCAGATCGTTCCCAGTACAAGAATACTATCTGGAAGATGTTATCCAGATGCTGGGGTTTGTACCACCAATACCTGAGAAAAAGAAGAAAAGAGATGATGTTGACGATGATGAAGAGGAAAACTGTAACATGATTTGCAGTGATCAGTACTCCTTTCAAACTAAAAACTCCATGGCACAACTTAGTGAACGAGAAATGTCTTTTGAATTGATAGAGGCTCTTCTAGATTACATCAGTAATCTTGGTGTACCAGGTGCCGTCTTGATCTTCTTACCAGGATGGAACTTAATCTTTGCTTTGCACAAGCATCTGACAATGCACAGAGTGTTTGGAAGTCAACAATATCGCCTACTCCCATTACATTCTCAAATCCCAAGAGAAGATCAGCGACGAGTGTTTGAACCTGTTCCTGAAGGCGTTACAAAGATCATCCTATCCACAAACATCGCTGAAACCAGTATTACTATTGATGATGTCGTGTTTGTCATCGATTCTGTCAAAGCTAAAGTCAAACTGTTCACATCTCACAATAACATGACAAACTACGCCACAGTTTGGGCGTCACATACCAACATGGAACAGCGACGTGGACGAGCGGGTCGTGTGCGACCAGGTTTTGCTTTCCACTTATGCAGTAGAACAAGAGCAGAGAGGCTCGCTGAGCATGCCACGCCTGAGATACTCCGTACACCCCTACACGAGCTTGCTCTGTCCATTAAGTTGCTGAAGTTGGGCGATATAAAAGAATTCCTTAACAATGCTATCGAGCCTCCTCCTTTAGATGCCGTGGTAGAGTCGGTGGCTATGCTGAAAGATATGGAAGCCCTCGACACCAACCAGAACCTAACTCCTCTAGGATACATGTTGGCTAAACTACCTATCGAACCTAGACTAGGAAAGATGGTGATTCTAGGCTGTATATTCCAATGTGGTGACGCCACTTGTACTATCGCCGCTAGTACCAGTTTTCCTGAACCGTTTGAGACCCCATCTGACCGTAGGAGACTGGGCTGGGTGCACAAGAAGTTTTCTGGGTCACGTCACAGCGATCATATTGCCATGCTCAGCGCACATCAAGCTTGGGAAGACGCTAGATCGGTTGACGATGAGTCGGCATCAGAAAGGAGTTTCTGTGACAGCCATCAGCTCAACATGTCAACGTTACGAATGACTGCCGAGGCGAAGCTTCAATTAAAGAATCTCTTGTGTAATGCAAACTATCCTGAAGACTGTATGCACCCAGAACCATTTAACTACAGTGGTCCAGATTCCAAGCTTGACATGGTTGTTGCTCTTCTGTGCCTCGGTCTTTATCCCAACGTCTGCATGCACCGTGAGAAACGTAAAGTCATCACAACAGAAGGCAAGGCTGCTCTGGTCCACAAATCCTCCGTGAACTGTACAAACAGGGAGTACATCTTCCCGTCACCTTTCTTCGTGTTTGGAGAAAAGATTCGCACCAGGGCGGTGTCCTGTAAGCAGATGACCATGGTGAACCCTCTGCAACTGCTGTTGTTTAGTCAGAGTAAAGTCACCTCTCAGAATGGCATCATCACAATTGATGATTGGATTCGGCTGCGCATGCCCCACAATCACGCCGCAATGATCGTAGCTTTACGACAAGCCATTGACGTGTTATTGATTCAAGCCGCGTCTAACCCGACGTCAATCGCTGAACCTTCACGTGAAGATGAGCGCGTTATTAGTATCATCAAATCTCTGTCACGAAACAATGCTGGCAAGTTTGTTCAGGGCGGAAATCAAGGTCCGCCTCCAGGACCGCTGTTTCGTGGTCGAGGCAGAGGGGGCTTTGGGCAAGGATCACGTGGTTTCATGCCCCAGAAGCGTGGCTACCAAGGTCCACGTCATTACCGTGGTGGTGGTGGTGGATTTCGTGGAGGCGGTGGTGGATTTCGTGGGGGGAGGGGTGGCTTTCGAGGTGGATATCGTGGTGGATACTGA

Transcript

gene14979.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q28141	ATP-dependent RNA helicase A OS=Bos taurus OX=9913 GN=DHX9 PE=1 SV=1
Q68FK8	ATP-dependent RNA helicase A protein OS=Xenopus laevis OX=8355 GN=dhx9 PE=2 SV=1
Q08211	ATP-dependent RNA helicase A OS=Homo sapiens OX=9606 GN=DHX9 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000685 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF21010 all species →	HA2_C	Helicase associated domain (HA2), ratchet-like	Domain	Interproscan
PF07717 all species →	OB_NTP_bind	Oligonucleotide/oligosaccharide-binding (OB)-fold	Domain	Interproscan
PF04408 all species →	HA2_N	Helicase associated domain (HA2), winged-helix	Domain	Interproscan
PF00035 all species →	dsrm	Double-stranded RNA binding motif	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR044445 all species →	Domain	DHX9, first double-stranded RNA binding domain	Interproscan
IPR014720 all species →	Domain	Double-stranded RNA-binding domain	Interproscan
IPR011709 all species →	Domain	DEAD-box helicase, OB fold	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR002464 all species →	Conserved_site	DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site	Interproscan
IPR048333 all species →	Domain	Helicase associated domain (HA2), winged-helix domain	Interproscan
IPR007502 all species →	Domain	Helicase-associated domain	Interproscan
IPR044446 all species →	Domain	DHX9, second double-stranded RNA binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18934 all species →	ATP-DEPENDENT RNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0003725 all species →	Molecular Function	double-stranded RNA binding	Interproscan
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0003724 all species →	Molecular Function	RNA helicase activity	Interproscan
GO:0004386 all species →	Molecular Function	helicase activity	Interproscan
GO:0005622 all species →	Cellular Component	intracellular anatomical structure	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0043138 all species →	Molecular Function	3'-5' DNA helicase activity	Interproscan
GO:0045944 all species →	Biological Process	positive regulation of transcription by RNA polymerase II	Interproscan
GO:0050684 all species →	Biological Process	regulation of mRNA processing	Interproscan
GO:1990904 all species →	Cellular Component	ribonucleoprotein complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K13184	DHX9; ATP-dependent RNA/DNA helicase DHX9	EC:5.6.2.6 EC:5.6.2.4	Translation factors	ko03012	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →