Gene detail

Detailed information of gene26428.t1 in Actinoscyphia liui

Genomic Location: chr8:3798716...3836051
NR annotation: XP_020908396.2, uncharacterized protein LOC110246394 [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

gene26428.t1

ATGTTTGGGTCAAAGTCATTGGCGGTTTCCGTCATAACATCGTCTAAAGATGCAATAATTCCTGTTTGGATTGATGAAGAAAATAGTAAACCTGAATGGAAGTACGGAGAGATACCGATACGGTCGATGGTTCCTTATCAGATCAAATTTCATGGCCAAATAGTGAACGAAACAGGATTCATAGTTATCAGTGATGCTAAAGAGGAAAATGAAAGGTGTTCTGGAAAGTCGACTGCTTTATGGAAACTGATTTGCAGCAAAAACTTAACATCAGCACCTGGTTACATCGCATCACCTTTTTATCCAACGTACTACGTGAATAATCTAGACTGTTTATGGCACATCACTGCACCTAGAGATCACGTGATTCGATTGGAATTTTTGGATTTTTTATTGGATGGATATAATCAGTGCAAGAATGACTTTGTACAAATTTACGATGGAGGTCAAGAGACAGGCACTTCTCTTGGAAAGTTCTGTCGTTACATTTCTCCACAGTTTGTGCAATCGTCTTCCAATGTCTTGACTGTTATATTCCACTCAGATGCCATGTTGATAGGTAGAGGGTTCAAAGCTTTGTTTACTTTCATTAAAGTAAACGACAAAAAACGACAATGTAGAAGATCTGTCAGAGACTGCCCACCTGGTTGCACTTGTCCTTCAACACAAAAAGGATATGAAAGAACTGTGGTAAAATGTGAGGAGCGCATACATGTACCAGAAAGAATTCCTCAAGACTCTATAGCCGTGATCCTAATAAACAACCTAATCAACATCATTAAAGAAAAGGCGTTCGATGGTCTTCCCAATCTCCTCTATATTGATCTCTCAAGCAATCGTATAGCCTATATCCATCCCATAGCTTTCTCCAATGCAACGTACACAGAATATATTCGACTGAACAACAATTTTCTGAAGGACATACCCCTTGCGCTTTTCCAACCACTGAGAAATGTTAAAACACTTGACTTGGGAAGAAACTTGCTAAAAGATCTCTCAGATAAAAGTTTTACTGGTCTGACTAATTTGAATATCCTAAGTCTTCGATCAAACAAAATAATAACATTACCAGTGGACATCTTTCAAAATACAACAAATTTGACGCATTTGTATCTACAGGACAATCACATTTCATCTCTGCCTGATGGAGTTTTCCGCTTCCTGCGTAAACTTGTTTTTCTAAATCTTTCACAAAATAAGATCACACTTATACGGAAAGGAACGTTTGAGGGTCTGCAGTCATTAAAACACTTAAATCTCACAGGTAACAGATTGTCTCGCATTGACCAAGATACATTTACAGAACTAAAGAATTTGAAAACTTTACAACTGGACAAATTCATCCATTGCTGCTATGCTGAAAAGACTATCCCAGGCCTAGACTGTAAAGCATCAGAGAAAAACGAGTTTTCGAGCTGTGACGATCTCATGAAAAATCAAACTCTGAGGGTAGCCATTTGGATTCTTGGGATAAGCGCTCTCCTCGGCAACTTGTTGGTCATTGGTAAAAGGCTTTTCAGCGAAAACACAGAGAATAACGTACAGTCTTTGTTACTGACCAATCTAGCGGTAGCAGATTTTCTTATGGGTCTTTACCTGGTCATTGTTGCGTCACTGGACATGAAATGGAAGGGAGAGTACTTTAAACATGATGTTGAGTGGCGATCAGGAGTTGGCTGTCGAATTGCTGGCATTCTCTCGATGCTGTCCAGTGAGGTTTCAGTGGGTATGCTAGTGGTGGTCACGTACGACAGGCTGGTTTGTATCGTCTTTCCTTTCACCATTAAAAAGACGCCCCGACGAGTAGCATTGATAATATGTGCCTGTGTTTGGATAACTGGTCTGCTTATATCGGTCATTCCAATTTTGGGTTTGGATTACTTCATCGACGACGACAAATTTGGTTTCTTTGGCAGATCATCGGTTTGTTTGCCACTGCAACTCTCCGCAGACCGCCCAGCAGGATGGGAATATTCTGTTGCAATTTTCCTGGCAATCAACTTCATCGCCTTCACCTTCATGCTCATGGCCTACATCGCCATAATTATTAAAGTCAAAAAGTCGGCAAACGCAGTTCGTTCCACGGCAACAAACAAGGAATCCTCACTTGCAAAGAGAGTCGTGTTTATCATCCTCACCGACTTCCTTTGTTGGATGCCAGTCATTATTTTTGGTATCCTGTCCCTCACAAAAACCTACAATGATCCCACGAAACAAGTGTACGTTTGGATTGCGGTGTTCGTACTCCCCATCAACTCCTCCATCAACCCATTCCTGTACACCTTTTCAACCATGAGAAACCAAAAACAAACAACCTCAAAACTATCCTCAGAGTTGGAATTGTTTCACATGTGTAAAACAGGAAAGGCACAAGTTAGGACTACGAGGGCGCTTCCAAGAGCTGGTGAAGGTGATGGTAATGACGACCAGCAAGAATCTCCAGAAAATGGAGCCAAGTCATCGGAGCAGATCAAGTACAGGATACAATTGTTAGAAAAGATGGACGTACAGAATAATAACGAGAAAGTTGGTTTTGCTATCGCAAACGTTAAGTCAAGCGGATCTACTGAATGCTGCCTGATCAAATACTTCAGTCCAGATAGGAAAGAGGATTGGAACAAAGAACTGAGCATAATTGCGCTGATGGACAAAACCAAACACGAACGAAGCAGTGAAAGTGTAGTAAAATATCGCTGGCATTGTGAAGCAAATGAGCATTCTACTGGTGGAGCGTGTGTTATTGTCCCGGAAATGCATAAAGCAATGCTGATCTGTTATGAATACGTGCCAAACAAACTGCTTCACGCTTTTCTGGAAGACGAGAATGTATTGACCTTTAAGATTTTGTGCTCCCTATGTATTGACATCATCTCTGCCATTGAGTATGTACAAGGATATGGTATCAGCCACAACAACGTCAACCCTAAAGCCATTGTTGTCCGTGAAAGTGATTCACAGATCGACCCATTCAGAGCAGTGTTAGTAGATTTCTCCCGAGCCAACCAGCTGAGAACCTATGAGGATGGTTCTTTCGGTAAAAGCGATATCATACAGTTTGCCCGCCTGGTTAGAATCTTGCTTAAACATTGCAAAGAGTCTACAGACTACAAACAGGTCAATGATGTTCTCTCCCTTTGTGATGCAAGGAGATCCAAAGCTACCACCAATATGATAAAGAACAATCTATTGCAAGCACAGAGAACTTCAGAGGAAGCAGAGGAAGCACACCTTGGATGA

Transcript

gene26428.t1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P46023	G-protein coupled receptor GRL101 OS=Lymnaea stagnalis OX=6523 PE=2 SV=1
Q8WXD0	Relaxin receptor 2 OS=Homo sapiens OX=9606 GN=RXFP2 PE=1 SV=1
Q5XM32	Relaxin receptor 2 OS=Canis lupus familiaris OX=9615 GN=RXFP2 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000149 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00560 all species →	LRR_1	Leucine Rich Repeat	Repeat	Interproscan
PF13855 all species →	LRR_8	Leucine rich repeat	Repeat	Interproscan
PF00431 all species →	CUB	CUB domain	Domain	Interproscan
PF00001 all species →	7tm_1	7 transmembrane receptor (rhodopsin family)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR017452 all species →	Domain	GPCR, rhodopsin-like, 7TM	Interproscan
IPR035914 all species →	Homologous_superfamily	Spermadhesin, CUB domain superfamily	Interproscan
IPR000859 all species →	Domain	CUB domain	Interproscan
IPR000276 all species →	Family	G protein-coupled receptor, rhodopsin-like	Interproscan
IPR002131 all species →	Family	Glycoprotein hormone receptor family	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR003591 all species →	Repeat	Leucine-rich repeat, typical subtype	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24372 all species →	GLYCOPROTEIN HORMONE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004930 all species →	Molecular Function	G protein-coupled receptor activity	Interproscan
GO:0007186 all species →	Biological Process	G protein-coupled receptor signaling pathway	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007189 all species →	Biological Process	adenylate cyclase-activating G protein-coupled receptor signaling pathway	Interproscan
GO:0007190 all species →	Biological Process	activation of adenylate cyclase activity	Interproscan
GO:0008528 all species →	Molecular Function	G protein-coupled peptide receptor activity	Interproscan
GO:0009755 all species →	Biological Process	hormone-mediated signaling pathway	Interproscan
GO:0016500 all species →	Molecular Function	protein-hormone receptor activity	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for gene26428.t1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →