Gene detail

Detailed information of gene27532.t2 in Actinoscyphia liui

Genomic Location: chr8:24552898...24562524
NR annotation: XP_028513142.1, uncharacterized protein LOC110233135 isoform X2 [Exaiptasia diaphana]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gene27532.t2

GCTTAGATTTAGTCAGTTATGCCGATCATGTTATACGAAGTAGAGTTTACAAACTTTTATCAACTCTACTGTACTGACGACCAAGACACTGAATGATATGGTGTATGCAGAGTTGTGGCAGTTAAAAGTTTTTCGTTATAATGTTTATATTATGTCATGAAATTTGAACAAAGTTTATAACGTCATGAAGAAGACAGTAGGAAGACAAGGAGTTGCTCTAGCTTCACATCGAGACGACCGTAGAAACAGACACCTTAAAACTGAACAATTCAAGTATGGCTCACAACCTAAAAAGTCAACTCAAGTAAAAACAAAGAAGAAGAAAAATTATAAACGCAAAGATAAAGGTCAAGATAATCTTGCTTATGATGAAGCGTCGACAGATTCAGACTCCTCCATTGAAGAACTCCAGCAAAGGGAGATACTCATTACTATAGTAACAGGATCACGTGGTGTTCTTGGTGACTTCGGTTTTGAGCTGATGGGTGGCAATAATGACCCAGATCTGGCGGAATACAACGATACTGGAATATACATTCAAGACGTCACTCCAGGATCTGATGTAGAGAAAACCCTAGACGGTGGTGATCAGATACTCAAAATTGGTGGACATTGTGTACTAGATGTACCTCTGCATCACGCGCTGAATTTAATACGAGCCGCGGATTCTAGAGTAGTCGTTAATATATTAAAACATCCAGATAATCCGATGAGTCCAACAATCCCAGACGACTCAGACGATGACAGTGGGCCTGAATTAGACGAAGATGAATTAAATGACGAAATTAGTTCAATCCTTTCTAGAAATTCACAGGGTGTTAATACTGCGGCATCTACAATGATGGTCGATGAGACTAACGATGGCGAGGAAGTAGATGTGATATTTATGAGTGGAAGGCCAGGTCATTTAGATGATTTAGACTTTGAATTTGCCGGTGGAAAAGATGCGCCTTATGTACCAAAAAACGGTGGAATATTCATAACCAGTGTCAAGTTTGGAAGTATATTAGAGGAAATCATTTCAACAGGAGATAAAATAATCAGACTTGAAGGTATTGACATCACCAATGTTCCACGGTTCACAGTGATAAACCTTATTCGTGCTTCACATGGTCAAGCAAGGATGACTGTAAGAAAAGCTAACAAACAGCAGGTAAATTTCAGTGCATTTGACGATGTAGAAGTCCGTGTGAACGTTTTAGGAGCAAAAGATGAGATTATCGTGGAGATCAAAACAGGACCTAAAGGTCGTCGCGGTCAGCTAGGGTTTAAGGTCACAGGAGGGCGAGATAAACCGTGCAAGCCTGGTGACCCTGGGGTGTTTATCAAAGAAGTAAAACCTGGATCCAAATTAGAGAAAATACTCAAACCTGGCGATAAGTTACTCAAGGTCGCAGGTAAAAACGTCACCAATTCAACACAGGGTCAAGTTCTGGATGTGATAAAAGCCGCTGACCGCAGAGTATTGCTGCATATCAAGAGAAGTTCTACAGATCCAGTAGACAAAGTCAAGAAGACGATAAGTGAATTGTTTGAGCCTTCACAGTTAGAAGAGTTTCTTGCAGCATTTGAGGTCTATTGCGACGATCGTGATCGAAAGATGGATATCTCTCGTCTACCAAGACTGTGTCGTGCTTTAGGGTTTAACTTGACAGAACAAGACTTTGAGCATATGACCACTCGCCATGAAAATGGAATTGGAAGAATCGCATTCCAGGAATTTGTGCACATGATAGGTGAATTTTCAAGTATACGACAAAAAGACAGGGACATTCTAGAAGCATTTGAGATTTTCGATCGTGAATGCCATGGTTTCTTTCTTCTGGAGGATCTCAAAGCTGCTTTTAGATGTATGCCAGGATACTCGACTTTAACTGATGAAGAGATGGATCACATTACGAAAACAGCTGATTCTAATGGAGACGGTAAAGTCTACTACCAAGATTTTAAGGAACTCGTTCTTCCAATATTTCACAAATATTGAAGTTTTCGTCAGTGGAATATTAACGACTTCCATCAATGAACGACAATAAGTACAAAAAATGTAAATGAATGAATGAATAACCTTTATTTAAACAGGGTTGTCCTTTCAGTGTGTATAACACGCTGTTATCAATAGGAGCCCTAAATGGAAACTACAGTTACTGTAGCAAGTCAACTAGTATGGGCTGCATACTGAAATGTAAATGTAAATCTGTAACACCTTATAAATGGAAACTAGCAAGTAAACTAGTATGGGCTGCATACTAAATGTAAATGTAAATCTGTGACACCTTATAAAAGGAGTAATACTAGCTTCTAGTTTACCGACGTCGACGTTTTGAGCTTTAGCTCTTCGTCGATCGTGCGATCGTGCTACGTTATTGCAGATTTACATTTATTCACCGATGAGCTAGTAAAAACTCATCCTGCACATGCTTATTAATTGAGACTCGAATGAACCATTTCGTTTGTATAATACTCTACGGCTATGTAGCTTTGTAATAAAATAATAAGCTAATACGATGCAATGTCTTGGGTTGTCACTCAGCACTCTAATTCAATATTTAATCTTTTTATGAAGCAGATAATCTCTCTATGGTCATCGCCCAGGGGCCGATCTAGGGGAGGGGTGCAGGGGGTGGGCACGACTTTTGTGCGCTTTTCATCTGACTGGTGTCCAGTGAGACCACAGGTAGCCCAAGCTATGCGCTTTTGGCGATTTTTTTGGTGTCAGTAAAATGATTGAAATAATTAAAAAAAAGTTGACCTATAAGTTTG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9LQN4	Probable calcium-binding protein CML17 OS=Arabidopsis thaliana OX=3702 GN=CML17 PE=2 SV=1
Q9AWK2	Probable calcium-binding protein CML11 OS=Oryza sativa subsp. japonica OX=39947 GN=CML11 PE=2 SV=1
P61861	Calmodulin OS=Colletotrichum gloeosporioides OX=474922 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002804 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF13499 all species →	EF-hand_7	EF-hand domain pair	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR050614 all species →	Family	Synaptic Scaffolding LAP/MAGUK Families	Interproscan
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR002048 all species →	Domain	EF-hand domain	Interproscan
IPR011992 all species →	Homologous_superfamily	EF-hand domain pair	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23119 all species →	DISCS LARGE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0009790 all species →	Biological Process	embryo development	Interproscan
GO:0016323 all species →	Cellular Component	basolateral plasma membrane	Interproscan
GO:0030054 all species →	Cellular Component	cell junction	Interproscan
GO:0043113 all species →	Biological Process	receptor clustering	Interproscan
GO:0045197 all species →	Biological Process	establishment or maintenance of epithelial cell apical/basal polarity	Interproscan
GO:0097120 all species →	Biological Process	receptor localization to synapse	Interproscan
GO:0098609 all species →	Biological Process	cell-cell adhesion	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for gene27532.t2.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →