Gene detail

Detailed information of gene28797.t1 in Actinoscyphia liui

Genomic Location: chr10:1374971...1377827
NR annotation: EDO48286.1, predicted protein [Nematostella vectensis]
Species Actinoscyphia liui · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gene28797.t1

AAGACTTCAAGACCGATCTTCGCTTCCAGAGCTCAGCTGTGATGGCCCTACAGGAGTCTAGCGAGGCTTACTTAGTTGGTCTGTTTGAGGACACCAACTTGTGCGCCATTCACGCCAAGAGAGTCACCATCATGCCCAAGGACATTCAGCTTGCCAGGCGAATCCGTGGCGAGAGAGCTTAAACTGGTTCTCTTTCATACACAAACAACGGCTCTTTTAGGAGCCACCACATGAATCAAAAGATCATGACCAAATGCTTTCTCAAAATCGTTAGATCAATGTATATTTCTTTAAAATTGACTCAGACCTTTGGTGTTGTTATCAGTAAACAATGACTGAGTATTTTGATTTTCATTCATTGAAAGTCATTACTGAAGTTATAATTGAAGATTTGGGGAGCTAGATTTGGTAATCAGGCATACCGTACTTATTATTGAATTTTGGGACCTTGAGGGTGGGCGCTTATTCGAGGTGAAAACCCTGTACGGTTTTAAAATTTGAAGTGAATTGAGTTGTCACTGATTGTTAGATTTATTCTAGACGTTATAAACTAGCGAGTAAACTAGAATGAACGTGAATAAATAAGTGTAAATCTGTAACACCGTATCAAAAAGATTATACTTCAGTTATGGAAATTTAATTTCGAGCATAAGCCCTTCGTTTTCATTTATTTCAAGATGAAGTATACTTTTTTTACGCCGGTGTTACAGATTTACATAGTGCCACGAAGCGTTACATTATTTTTGGCGCGAAGTGTCACAATCTTCAACGGTATGTTCTCTACAGCACTGAACGCACACACTTTATTTTTGTTTTAAGATGTCTTTATTGCTGGCATCTGCTAGCCTGTTATTTTATTGCAAAACAGTGAGTCTTTTATACGCTTAGAGGAGAGAAAGAACCGTTGAATATTGAGTCTTGGGTTGGCGCCAAAAGATAAAGACAAATTGTTAGCACTGACATCGCGGTATGTTTGCGGTTCTGAATTCACGTTTGCTCGCTTTCAACATGTTCAATGCGTAGTAGACTGAAAGTATTCTAAAAAATCCAGCGAAAGCTTGATCCCAACTAATTAACACTTAGCAGTTATAATTTCTAAAATTAGTTAATTATATAGATTTAGACACTTGTCACAACAAACGACTTGACTTTGAGGTTCTGTGAGGACCTGTAAAGCCCCTTTGTCTGTGACAAATTTTCTATGACAAGTTTTCTTTGCTCGTACCCTGCAAGCAGAGATATGTCAGAAGAGAAAGGAAAATAACTCTGCTCGCGGACTTTGCTCGTGTATTTGAGAAAATTTGACCAAATTTCATGTGACAAACACATACAAAATTTGTCACAGAAAATTTGCTCGTGTAAAAGGGGCTTTTAAAATAGACCAATATTAATAATTTTACTGCAACACCTAGAAATCAGAGCTCTTGTAATCGTTATAAAATATCAAAATATCTATAGATTTCAATATCTTCGCGTGTGTCAATTCTCAATGAAGCATTTTGATTTATGTAGGTTAGAATCAAAGTCGTTTTTAGACTGTTGAGCTATAAACTCTATATAACATTACAAGTTTAAATCAGAACTCTCAGAGTATTGTTATTCTTGTTGCTGAGGTAAAATTCTTAAAGTCAATTCTCCAAGCGTAAATCTTTTACAAGCAATTGGCGGCAAAAGGTCAAGACCATTGTACGACAAGTGTGTTTGTTGCTTGAACTAAATCTCAAAGTTCTTCGAAGTGTATGATATGAAAGCCAAAATACCAACATTTCTAAGTTGCCACATAAATGAACATTTGTTTTCTTTATAAATTATGAAGATTTTTCTCTCCAAGTCTTATTAATTCATAAGAATACTCTGGCAACCCAATGACGGGACGCTGTCACATACACACATAATCTTCCATAACATTTGTTAGATTGTCAAGATCCTCACCAAACTAAGTCTAGATATTTTTAGTGAGTATGTTCATCTTTCAAAATAAAAAAAAGTAAAGAAATAAACTGGCATCGAGAAGAAATGTTCTTCCAAAGTCACACAACAAACACACGTATTGACTGCCGCCATCACGGCTCTGTTTCCATGGAGGTTCGACACTGCATATAAATAAACACGGCACGCGGTTATCGCGCCATTATTTGAACTCCGATTGCAAAGAGAAATAGTTTTTTTACTAAGTACAATCCTGAAAATGTCTGAAGCTGCAGCACAGAAAAAGGTTAAAAAGCCTGCCAAACCGGCCGAACACCCAAAATACAGTGAAATGGTCAGTGCTGCTATAGCTGCCTTGAAGGAACGCAATGGATCGTCCCGCCAAGCCATCGTCAAGTACATCAAGGCCAACTACAAAGTCGGTGACAACTATGGAAGCCACCTGAAGCTCGCTCTCAAGCGTATGTCCGACAGGGGAGCAATCGTTCACACTAAAGGCACAGGGGCCTCTGGTTCCTTCAAGCTTGCCAAGCCAGTCAAGCCAGTTGCCGAGAAGAAACCCGCAGCTAAGAAAGCAGCCGCTAAGAAGCCCGCTGCCAAGAAACCCGCCAAAAAGCCCACTGCCAAGAGACCCGCGGCAAAGAAGGCGGCCGTAAAGAAGTCTACTGCTGCTAAAAAGCCTGCTAAGAAACCAGCAGCAGCAAAGGGCAAGAAACCCGCTTCCAAGAAACCTGCTGCCAAGAAACCTGCTGCCAAGAAACCAGTAGCCAAGAAACCCGTAGCAAAGAAGGCAGGCAAGGCTAAGACAGCAGCCAAGAAGGGAGCCAAGTCACCCAAGAAGTAAAGTGTTCATACACACAAACACAAACGGCTCTTTTAGGAGCCACCCACATGAATAAAAAGCAATGACATATATGCTATAACAAGG

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5NVN9	Histone H1.0 OS=Pongo abelii OX=9601 GN=H1-0 PE=2 SV=3
P15870	Histone H1-delta OS=Strongylocentrotus purpuratus OX=7668 PE=3 SV=1
P07305	Histone H1.0 OS=Homo sapiens OX=9606 GN=H1-0 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000434 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00538 all species →	Linker_histone	linker histone H1 and H5 family	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR005818 all species →	Domain	Linker histone H1/H5, domain H15	Interproscan
IPR005819 all species →	Family	Linker histone H1/H5	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11467 all species →	HISTONE H1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000786 all species →	Cellular Component	nucleosome	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006334 all species →	Biological Process	nucleosome assembly	Interproscan
GO:0030527 all species →	Molecular Function	structural constituent of chromatin	Interproscan
GO:0003690 all species →	Molecular Function	double-stranded DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0030261 all species →	Biological Process	chromosome condensation	Interproscan
GO:0031492 all species →	Molecular Function	nucleosomal DNA binding	Interproscan
GO:0045910 all species →	Biological Process	negative regulation of DNA recombination	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K11275	H1_5; histone H1/5	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Co-expression network

Genes whose expression across the transcriptome samples of Actinoscyphia liui tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

No co-expression network has been built for this species, so this gene has no partners to show. Networks are available for the species listed on the Network Analysis page.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Actinoscyphia liui, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	no expression matrix	–
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →