Gene detail

Detailed information of gfas1.m1.14543.m1 in Galaxea fascicularis

Genomic Location: xfSc0000071:161903...170874
NR annotation: XP_020608348.1, transcription factor Dp-1-like [Orbicella faveolata]
Species Galaxea fascicularis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gfas1.m1.14543.m1

AAGATCGTTTGTCAGGGCCTGGAGTCGGTGCAAAAACATGTCTGCTCGAGCGAAGAATTGAGAAAGTACAGCACGATTTCTCGTAAAGTGACCCTCAATTATGCCTCAGGAAACGATCTTGCACTAGAACTAACATTTTTACTCACTTTAAAAGCGATCGCGTGGAAATCAGAACAATTTTTGGGTGGCGATTTGACAAGTTTGTTTCAGATCTGTACCTCTGTGGTTTTGCGCAAACTTTGGCACACGATTCACCCATGCGATCACTTCGCTCTTCACTGAGAGAATTAAGTTCGCCTTAGATTGTACCGATGTCGAATCCTACAGCCACATTGACAAGCTTGTGGATCGAAGGTCAACCTAGCCCAGTGAAAAGCAGCCCCTCCACTCCAGTTAAAGGAGCTGTAAATCGGGACACTTCCATGGTTCAGGAAGACTTCCTAAAGTTTTATAAGGACAGTGGTCTTGAACCTTTGGCTAGAGAGGTTGGCGTCATAGACAACAATGGAACTATAGATGGTTTGAAAGATTCCTCTCAGCCTAAAGTCAACAGTGATCAGCCAAAACCAACTATTATACCCGTTACTACAAAACTGTCTCCAGTTATTTTACCTAAAACAGTGAATTCAGCACCATCGCCAATGGTCATTGGTTCTCCTGGTCCACATCAGGTCATTGCTGTCGGTGGAAGTCCAAGAACTCCAGCAATGATTGCTGCACCAATTATACCAGCTAATACAGCGACATGGCCAACAAGAGTAAACTCTACTCCAAGCAGTGGAAAGAAAAGAAGGCTTGATTTAATGGAAAATGATAATTTGCTTGATAGTGCAGAAAGGAAAAAGGGCAAACGGTTACCCAGCGCAGGTCGCTCAGGTGGAGGAGATAAGAGTGGGAAGGGACTGAGACATTTCTCAATGAAAGTTTGTGAAAAGGTTCAACAAAAAAGAACAACATCCTACAATGAGGTTGCAGATGAGTTGGTTCAAGAGTTTAGTGACCCTGACAAGCATCTGTCACCAACTGATCAGGCATATGACCAGAAGAACATCAGAAGAAGAGTTTATGATGCCTTAAATGTTCTGATGGCCATGAACATTATTTCAAAGGAAAAGAAAGAAATCAAGTGGGTGGGACTACCTACAAACTCTGCACAAGAATGCCAGCAGTTAGAGGAGGAGAAAAGAGAAAGACAGGAAAGAATAAGACAAAAGACGGCTGAGTTGCAGGAACTGATTCTTCAACAAATTGCTTTCAAGAATCTTGTTCAAAGAAACAAGCAAGTTGAAAAGGAGCAGGGATCTCCTGCTCATAACACAGCTATTCATCTTCCTTTCATCATTGTGAACACAAGCAAAAAGACAGTCATTGACTGCAGCATATCTAATGACAAATTTGAATATTTATTCAACTTTGACAACACATTTGAGATCCATGATGACATTGAGGTGCTCAAAAGAATGGGTATGGCGTTTGGTTTGGAGAAAGGACAGTGTGCAGAGGCCAACCTGAAGGCTTCAAGAACAATGGTTCCCAAAGCTCTTGAACCATATGTTTTGGATATGGCAAAGTCGGGACCAGTTGGACTTCAAGGAACCCTTGGCAATCATAACACTCCTAACAATTCAGCATCTTCGGCTTCTCCACTGATTTCAGCTACAGCTCGCATGTCTCCTCTTCCTGTGTCAAATGCCCCTTCATCTCCCCTGGCTATGCCTCTAGGGCATGGCACATCCCCTGTCATCACAGCTGCCAATTCAAGGGCACAGAATCGCACTTCAAGGACATCATCCATGGCAAGTGACAGTGGCCCCTCGCATCGAACCATGTCTCCTTACTCGTTCCCCTCTTCGCCAGCCTCAGACGCATCCTCTGATTTATCACAGGATGGATTTATGGACACAGATGAACCTAATTCACACCACTGATTTTTATGGCAGCATTATATTCTCAAAATTTTAGAAGTGTACATGTGTTTGTGAGTTCATAGGATCAACAATGCAGGGTTTAGGCTTCAAATTGAGAACAATTTACCAACTACTTTTGGATTGTGATGGGCTCTCACATGTTTGAACATTGCAGCTTATTCATAAGTCCTGATTTGTGTGTAGCCATTTAGAGGCTTTTCCACATAGATCACTCCAAGTTATTTGACTCAAGAATGCAGCCCATTTTTGTCTATCTCCAGAGTTTGTAATAATGCACAGCATTTCAAAGTGTAAAACAAAAAAAAAGGGGAAAATAATATACCATTGTAGTATAGTAAATGTGTTTATTGGCTTGAGTGGCAAGTTGCAAAACCAAACAATGGTGAAGTAATTTTGATGGTAGTATTCTTTGGCTTTGGTTGATAATTATTAGTATTTACAATCTTATGTCACTGAGTTGGTTTCTACCATGTAGAGTACATGATGTGGCAAGAGCAAGGCTCTAAAATGTGTCATTCCAGAAAATATCAATACCCAAAGGCAGGTTATTAACTTGACCCTCCTCCCCCCTTCGTCAGGAACTTGTCTTTTGAAAACTAATCCAACTTAACATGTCTGATGAACTTACATGGGAGGGTATGGATGTTTTCTGGAAAGGCACAACACCGATGACAATTCCAAACTCATCCACAGGTTTATTATATTATCAAGCACCACTAATCAGGTTAGCGGATTGAAATGTGCAGGGATGGGTTCCGTTATGTGCAACAAATAAACAGGTGTTTTTGAATGCCATGTAACTTGTCATTTTAAAAACAAAAAAAAGAAACAAATTTCTTGAAACCCTGTCTTGAGCATGGATGCAATAGAATTTGATGTACTTGCATCTTCATAACAGCATTTGCCAGCTGCTGTGAGTCTTCAGTTTTTTAGGAACATTAATCAACTGACTGGGAAGTTAAAATTTTATTATTTAAATATTTTCTTCTATTGCCAGGTTCAGTGATATCTGCAGACCACTGCATTTAATTTCAATGGGAAACCTAAGGAATAAAACAAAGCAGTTCTTTTTCTTTATTTTTGCGCATTCATGTTTTAAACAATAAAGCATTTTCAACATCAATCATTTTTGGTTGCAGCTGTGTTCACTTCCTTCAGTAGCAAACCACACTTTGTTTTGGCAGGATTATTCCTTTGCAATGCCTGTGTTATTCCTGTCATGATGACCTAACTGGAAAAATTCATCTCCCACAAAATCCAAGAACTAAAAAAGCAAGATGATAACATGTTTACTTTGTTAACTTAGCTTGCGAAATAATGAGTTCTTGGTTAAAGTCTTGTTTATAATCCTATTCCACCTGGCAAACAAACAACGTTAATAATTATTGTGTTGTTAAATATGCACTATCTATTCCACTATTAGTTTCACAGAATTTCCAATGAATATGGTGACAGTTCTCTCAAGAATGAGGGTTTCAGAAAAGACCTTCATTATTCTTTCATAGCTCATTAAAAACACTTTATTGGCTTTCCTCAATTTGGTAGGTAATGGATGGTGTCTATTTAGAGAGCTCACGGCACATTCATTGCTGCATTGTATTTAC

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q17QZ4	Transcription factor Dp-1 OS=Bos taurus OX=9913 GN=TFDP1 PE=2 SV=1
Q08639	Transcription factor Dp-1 OS=Mus musculus OX=10090 GN=Tfdp1 PE=1 SV=1
Q14186	Transcription factor Dp-1 OS=Homo sapiens OX=9606 GN=TFDP1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004437 (this species only) · gene tree & orthology
Transcription factor family	E2F · all TF in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02319 all species →	E2F_TDP	E2F/DP family winged-helix DNA-binding domain	Domain	Interproscan
PF08781 all species →	DP	Transcription factor DP	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR003316 all species →	Domain	E2F/DP family, winged-helix DNA-binding domain	Interproscan
IPR014889 all species →	Domain	Transcription factor DP, C-terminal	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR037241 all species →	Homologous_superfamily	E2F-DP heterodimerization region	Interproscan
IPR038168 all species →	Homologous_superfamily	Transcription factor DP, C-terminal domain superfamily	Interproscan
IPR015648 all species →	Family	Transcription factor DP	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12548 all species →	TRANSCRIPTION FACTOR DP	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005667 all species →	Cellular Component	transcription regulator complex	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0000977 all species →	Molecular Function	RNA polymerase II transcription regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0051726 all species →	Biological Process	regulation of cell cycle	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04683	TFDP1; transcription factor Dp-1	-	Chromosome and associated proteins	ko03036	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of gfas1.m1.14543.m1 across 22 RNA-seq samples of Galaxea fascicularis. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

22Samples

22TPM > 0

4Conditions

126.8Max TPM

86.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
coral holosome · Control	7	7	88.76	119.41
coral holosome · 30ic treatment	6	6	76.09	99.81
coral holosome · Prometryn (herbicidess) treatment	5	5	83.29	91.35
coral holosome · Prometryn (herbicidess) and 30ic treatment	4	4	102.40	126.78

Per sample · hover a bar for the full sample record

Show the sample table (22 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR27118485	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	119.41
SRR27118492	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	100.32
SRR27118480	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	89.64
SRR27118491	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	82.40
SRR27118488	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	81.83
SRR27118486	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	74.35
SRR27118487	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	73.35
SRR27118477	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	99.81
SRR27118478	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	86.27
SRR27118476	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	83.66
SRR27118479	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	80.78
SRR27118466	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	78.01
SRR27118468	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	28.00
SRR27118484	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	91.35
SRR27118482	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	81.85
SRR27118483	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	81.74
SRR27118481	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	81.59
SRR27118469	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	79.93
SRR27118489	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	126.78
SRR27118490	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	97.26
SRR27118472	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	93.92
SRR27118475	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	91.65

Source: CnidoSite RNA-seq expression matrices (GFASC_TPM, StringTie quantification over 22 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Galaxea fascicularis tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	19	gfas1.m1.23287.m1	0.865344249348849
Negatively correlated	85	gfas1.m1.210.m1	-0.87360266913022

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Galaxea fascicularis, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →