Gene detail

Detailed information of gfas1.m1.2575.m1 in Galaxea fascicularis

Genomic Location: Sc0000095:107771...115779
NR annotation: CAH3032518.1, unnamed protein product [Porites lobata]
Species Galaxea fascicularis · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

Transcript

gfas1.m1.2575.m1

CATTAACAGCTGTCAATATTCAATCACCACAGTTAACGGAGTGGATTCGGGTTACAGTCTTACGTAAACAGCCGACAACAACTGATCTTCCCTCTTATCAAACATGAAAGGCAGGGTTATTATTTTTTCTATCACTGGTTGCCCATTTTGTATGCGAGCCAAGGACAAAATGCAAAAACTTGACATAGAGTACATCGACGTCAACTTGGACATTTATCCCGAGCGACGGGCCGAAGCGAAGGAAAGATCGGGTAGGAATACAGTTCCTCAGATATTCTTCAACCAGAAACACATCGGCGGTTTCGACGACTTCGATAAACTGACTGAGACTGAACTTCAGGAGCTGATCAGGGAGGTTGAAGAGAACCCAGCACCACCTGACGCACCTCAGCCACCAGAACCCAAGCCCACAGGCGAAGGTGAAGGAAATGCAATGGATGGTGAAGAGATTGACTTCACTTGTGAATTGGATGAGTATGCCCAGCTTGTCAAGGACTTCAAGGAAAGTGGAGTTATAAGAGACCACCGCAAGGGCTTAAAAAACTACAAAAACTCCTTCCTTGGCAAGGAAGCTGTGGATTGGCTAATGTTATTCAAGAAAGTAGACCGAGAGAAAGCAATAGAGATGTGTCGTCAGCTTGTTGAGCGCAACTTTGGGCATAGTTTGGAAAAAGGAAAGGAGACAGAGTTCAAGGATGATGATAGCGTTTATCGTCTTCTTGAAGATGATGAATCGACTGCGCTGAACTCAGGAATGAGCTCTGCGTGCGAGCCTCGACCCGCCCCTCAAGTGGCAGAAGAATTGAGGCGCTCAATCCTTAAACTGTACAGTCAGTTCTTGTCTAAGGATGGAAAGGGAGTAGACTACAAAGGCATGGCTGAGAGCAGTGAATTCTTGGCGTACATAAAGCACACTGCTGAACTACAGCGTGTCAAGCTGGAGGGAATGACCAGAGAGGAGACACTCGCATTCTTTATTAACATCTACAATGCACTGGTTATTCACGCTAATGTTGTCAGGGGACCTCCAGTCACTTTGTGGCAGAGATACAAGTTTTTCAACACCGTTTGCTACGTTATTGGAGGTCACAACTATGCCCTCAACGAGATAGAAAATGGCGTTCTTCGTTCAAACCGCAAGGCCATTGGTGCTGTGACGAAGCCTTTCTCAAAGAACGACCCTAGGTTGAAAATAGCGTTACCCGCACCAGAGCCCAAGATACATTTTGCTCTTGTGTGCGGCGCTAAGAGCTGTCCACCGATAAAGACCTACACCTCTTCGGGAATTGACGAGGAATTGTCACTTGCGGCCGAGGCTTTCTTGGAAGGGGAAGATGGATGCGTACTCAACATGTCCAAAAAAGAGATTCGGCTAAGCAAGATCTTCTATTGGTACAAGGAAGATTTAGGCACTAACAAGGAAGAGCTTGTGCGCTTTGTGCTGGCTCATATGGGAAAAGGAAAAAAGAAGGATAATCTGGAAGAGCTTTTAATCGGCGGTAATTTTAAAGTCGTCTTTATGAAGTACAACTGGGATCTCAATTCGAAGCACTAGGACCTTAAAACACAACATTCTCCTTTGCGGACGTGGGACCATTTTTTGACAACACCAGCCAGATAGCGGATGACATACTGTCACAAGCAGAAAAAACGTCTATCACACGGTTCCGCAGTTGTTTTTAAACATTAGTAAAATTAAAAAGACTGTGCGATGCGTATATCTTTGTGTTACTTAAGCTTATTTTCTTTTTGTTTTCGGTGCGATACTAGAAAGTCTCGTAAATAATAATATTACAAACTCAAAACAAGTTTCGGATTTCGCTCTATTAGAAGAAATCGCGTGTTTTGAAGATACTTATTATAAATTTTATTAACGTGTCAAAATGTACTTGGAATAGGGTGAACGCGGCCATGTTGTAGAACGTGACAACACATGCACTGAGGTCTTTCCCCTTGTTTAAAAGTAATGAACTCAGTTTGTCTTCATACATTTAGTGTAGTTTCGTGCAGATTAATATTTATGAATAATGAGAAACGTTTGTCATACCGCAATATAAATATGGTAAACGCAGCCAATGTCCGTCCAAGCACCTTCCAGTTATTTAATAAAATGCCTTGGAAAACATCA

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9HU55	Glutaredoxin OS=Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1) OX=208964 GN=grx PE=3 SV=1
Q68XG4	Glutaredoxin 1 OS=Rickettsia typhi (strain ATCC VR-144 / Wilmington) OX=257363 GN=grxC1 PE=3 SV=1
P68688	Glutaredoxin 1 OS=Escherichia coli (strain K12) OX=83333 GN=grxA PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002373 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04784 all species →	DUF547	Protein of unknown function, DUF547	Family	Interproscan
PF00462 all species →	Glutaredoxin	Glutaredoxin	Domain	Interproscan
PF00610 all species →	DEP	Domain found in Dishevelled, Egl-10, and Pleckstrin (DEP)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000591 all species →	Domain	DEP domain	Interproscan
IPR051548 all species →	Family	Glutaredoxin-like Electron Transport	Interproscan
IPR014025 all species →	Domain	Glutaredoxin subgroup	Interproscan
IPR006869 all species →	Domain	Domain of unknown function DUF547	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR002109 all species →	Domain	Glutaredoxin	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR036249 all species →	Homologous_superfamily	Thioredoxin-like superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR34386 all species →	GLUTAREDOXIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0035556 all species →	Biological Process	intracellular signal transduction	Interproscan
GO:0009055 all species →	Molecular Function	electron transfer activity	Interproscan
GO:0045454 all species →	Biological Process	cell redox homeostasis	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for gfas1.m1.2575.m1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of gfas1.m1.2575.m1 across 22 RNA-seq samples of Galaxea fascicularis. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

22Samples

22TPM > 0

4Conditions

205.9Max TPM

126.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
coral holosome · Control	7	7	120.38	167.91
coral holosome · 30ic treatment	6	6	122.73	168.03
coral holosome · Prometryn (herbicidess) treatment	5	5	123.87	168.30
coral holosome · Prometryn (herbicidess) and 30ic treatment	4	4	144.85	205.93

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR27118492	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	167.91
SRR27118488	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	143.31
SRR27118491	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	123.71
SRR27118487	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	117.97
SRR27118486	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	114.76
SRR27118485	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	98.79
SRR27118480	coral holosome · Control	coral holosome	not recorded	Control	SRP476288	76.23
SRR27118466	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	168.03
SRR27118468	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	156.97
SRR27118476	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	138.88
SRR27118478	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	120.30
SRR27118479	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	107.82
SRR27118477	coral holosome · 30ic treatment	coral holosome	not recorded	30ic treatment	SRP476288	44.37
SRR27118483	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	168.30
SRR27118469	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	138.63
SRR27118482	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	131.26
SRR27118481	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	101.39
SRR27118484	coral holosome · Prometryn (herbicidess) treatment	coral holosome	not recorded	Prometryn (herbicidess) treatment	SRP476288	79.74
SRR27118489	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	205.93
SRR27118475	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	131.62
SRR27118490	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	123.77
SRR27118472	coral holosome · Prometryn (herbicidess) and 30ic treatment	coral holosome	not recorded	Prometryn (herbicidess) and 30ic treatment	SRP476288	118.07

Source: CnidoSite RNA-seq expression matrices (GFASC_TPM, StringTie quantification over 22 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.